ID: 1123026743

View in Genome Browser
Species Human (GRCh38)
Location 14:105428256-105428278
Sequence AGTGGAATTGCACAGCATGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 149}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123026737_1123026743 6 Left 1123026737 14:105428227-105428249 CCGTTTTGCCTTGTCCAGAATGT 0: 1
1: 4
2: 8
3: 27
4: 314
Right 1123026743 14:105428256-105428278 AGTGGAATTGCACAGCATGTGGG 0: 1
1: 0
2: 0
3: 19
4: 149
1123026739_1123026743 -2 Left 1123026739 14:105428235-105428257 CCTTGTCCAGAATGTGGTAGAAG 0: 1
1: 0
2: 2
3: 13
4: 190
Right 1123026743 14:105428256-105428278 AGTGGAATTGCACAGCATGTGGG 0: 1
1: 0
2: 0
3: 19
4: 149
1123026741_1123026743 -8 Left 1123026741 14:105428241-105428263 CCAGAATGTGGTAGAAGTGGAAT 0: 1
1: 2
2: 1
3: 73
4: 468
Right 1123026743 14:105428256-105428278 AGTGGAATTGCACAGCATGTGGG 0: 1
1: 0
2: 0
3: 19
4: 149
1123026736_1123026743 10 Left 1123026736 14:105428223-105428245 CCTGCCGTTTTGCCTTGTCCAGA 0: 1
1: 0
2: 1
3: 39
4: 450
Right 1123026743 14:105428256-105428278 AGTGGAATTGCACAGCATGTGGG 0: 1
1: 0
2: 0
3: 19
4: 149
1123026735_1123026743 23 Left 1123026735 14:105428210-105428232 CCTATTTTCTGTTCCTGCCGTTT 0: 1
1: 0
2: 2
3: 19
4: 296
Right 1123026743 14:105428256-105428278 AGTGGAATTGCACAGCATGTGGG 0: 1
1: 0
2: 0
3: 19
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123026743 Original CRISPR AGTGGAATTGCACAGCATGT GGG Intronic