ID: 1123027092

View in Genome Browser
Species Human (GRCh38)
Location 14:105430750-105430772
Sequence GATGACTCACGAGCTAAGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 140}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123027089_1123027092 -7 Left 1123027089 14:105430734-105430756 CCCGCTGCCTGTTTTTGATGACT 0: 1
1: 0
2: 0
3: 22
4: 342
Right 1123027092 14:105430750-105430772 GATGACTCACGAGCTAAGAATGG 0: 1
1: 0
2: 2
3: 29
4: 140
1123027087_1123027092 20 Left 1123027087 14:105430707-105430729 CCTCTCGTACAGGGATTGGCAAA 0: 1
1: 0
2: 2
3: 18
4: 99
Right 1123027092 14:105430750-105430772 GATGACTCACGAGCTAAGAATGG 0: 1
1: 0
2: 2
3: 29
4: 140
1123027090_1123027092 -8 Left 1123027090 14:105430735-105430757 CCGCTGCCTGTTTTTGATGACTC 0: 1
1: 0
2: 2
3: 29
4: 331
Right 1123027092 14:105430750-105430772 GATGACTCACGAGCTAAGAATGG 0: 1
1: 0
2: 2
3: 29
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123027092 Original CRISPR GATGACTCACGAGCTAAGAA TGG Intronic
903460115 1:23514951-23514973 AATGACCCATGAGCTAAGAATGG - Intronic
904278350 1:29399118-29399140 CATGGCTCATGAGCTAAGAATGG - Intergenic
904759965 1:32795902-32795924 TATGACTCATGAGCTAAGAATGG - Intronic
910675717 1:89814707-89814729 GATGACTAACGAGTTAATCAAGG + Intronic
913163050 1:116162699-116162721 TATGACTCTCAAGCTAAGACTGG + Intergenic
914957436 1:152175512-152175534 TAAGGCCCACGAGCTAAGAATGG + Intergenic
917374778 1:174338835-174338857 TAGGACTCCTGAGCTAAGAATGG + Intronic
918733074 1:188022867-188022889 GATGACTCATGTGCTTAGAGTGG - Intergenic
919207922 1:194440916-194440938 TATGACTCAGGACATAAGAATGG + Intergenic
919248232 1:195016263-195016285 GATGCCTCTCAAGCTAAGAATGG - Intergenic
920268051 1:204741341-204741363 TATGGCTCCTGAGCTAAGAATGG - Intergenic
921422213 1:214961495-214961517 CACAACTCAAGAGCTAAGAAAGG - Intergenic
922633934 1:227144724-227144746 CATGGCTCACAAGTTAAGAATGG + Intronic
924209563 1:241750419-241750441 GATAACTGATGACCTAAGAATGG + Intronic
1064000434 10:11659484-11659506 TATGAACCATGAGCTAAGAAAGG - Intergenic
1068301285 10:55144181-55144203 ACTGACTCATGACCTAAGAATGG + Intronic
1068838210 10:61579758-61579780 GATGACTCAGAAGCAAGGAAGGG - Intergenic
1071168618 10:82836013-82836035 TATGGCTGACAAGCTAAGAATGG + Intronic
1071866040 10:89733035-89733057 GATGAACCACCAGCAAAGAAAGG + Exonic
1073564151 10:104521016-104521038 GATGAACCAGGAGCTAAGAGAGG - Intergenic
1073907889 10:108305603-108305625 GATGACTGACTGGATAAGAAAGG + Intergenic
1082822280 11:57552232-57552254 AATGACTAACAACCTAAGAAGGG + Exonic
1082935808 11:58655506-58655528 GATGATTAAAGAGCTGAGAAAGG + Intronic
1083557861 11:63646382-63646404 TATGACTTGTGAGCTAAGAATGG - Intronic
1086419709 11:86626732-86626754 TATGACTGGTGAGCTAAGAATGG - Intronic
1088233191 11:107694295-107694317 AAGGCCTCAGGAGCTAAGAAGGG - Intergenic
1088513521 11:110601596-110601618 GATAACTTGTGAGCTAAGAATGG + Intronic
1091097462 11:132837713-132837735 GATGACTCCAGTGCTAAGACTGG + Intronic
1091784879 12:3237312-3237334 GATGACTTACGATCAAAGACAGG + Intronic
1092199927 12:6574904-6574926 TATGGCTCAAGAGCTAAGAATGG + Intronic
1092818602 12:12332484-12332506 TATGACTTGCAAGCTAAGAATGG + Intronic
1092845151 12:12577971-12577993 GGTGACTCACGAGCTATGGAGGG + Intergenic
1092933440 12:13338698-13338720 GATGATCCTTGAGCTAAGAATGG - Intergenic
1094335876 12:29352704-29352726 TATGGTTCATGAGCTAAGAAGGG - Intronic
1094599783 12:31898392-31898414 TATGACCCATGGGCTAAGAATGG - Intergenic
1094740654 12:33284542-33284564 TATGCCTCACAAGCTAATAATGG + Intergenic
1096305492 12:50471166-50471188 TATGGCTTACAAGCTAAGAATGG - Intronic
1096426492 12:51508119-51508141 GATGATACAAGAGCCAAGAAGGG + Exonic
1100315139 12:93438365-93438387 TATGACATATGAGCTAAGAACGG + Intronic
1101399761 12:104377203-104377225 GAAAACTCACGGGCTAGGAAAGG + Intergenic
1101975839 12:109357927-109357949 AATGACACTTGAGCTAAGAATGG - Intronic
1103283647 12:119782178-119782200 TATGGCCCACAAGCTAAGAATGG - Intronic
1104444354 12:128821925-128821947 GAGGATTCACAAGCTAAGAATGG - Intronic
1108012575 13:46034785-46034807 GATCACCCACAAGCTAAGGAAGG + Intronic
1110767313 13:79295441-79295463 GCTGCCTCAGGGGCTAAGAATGG - Intergenic
1110802227 13:79711967-79711989 TATGACCCAGAAGCTAAGAATGG + Intergenic
1110872095 13:80464144-80464166 GAAGACACACGACCTCAGAAAGG - Intergenic
1114754133 14:25239872-25239894 GATGATTCAGGAGGTAGGAAAGG + Intergenic
1118372555 14:65149892-65149914 TATGATCCATGAGCTAAGAAAGG + Intergenic
1118417283 14:65555075-65555097 TATAGCTCATGAGCTAAGAATGG + Intronic
1121917289 14:97847175-97847197 GATGCCTCACAAACTAAGAATGG + Intergenic
1123027092 14:105430750-105430772 GATGACTCACGAGCTAAGAATGG + Intronic
1127402781 15:58607090-58607112 TATGGCTCAGAAGCTAAGAACGG - Intronic
1127815364 15:62604130-62604152 TATGGCTCAAAAGCTAAGAATGG - Intronic
1127850669 15:62909450-62909472 GATGACTCACTGACTAAGAAAGG - Intergenic
1128047516 15:64631999-64632021 TATGGCTTATGAGCTAAGAATGG + Intronic
1137407283 16:48199587-48199609 GATGGCTCTCAATCTAAGAATGG + Intronic
1137872869 16:51967509-51967531 TATGGCCCAGGAGCTAAGAATGG - Intergenic
1137883331 16:52075708-52075730 GATGACTCATGAGACCAGAAAGG - Intronic
1138307798 16:55994239-55994261 CATGACCCATGAGCTAAGAATGG - Intergenic
1138318175 16:56088247-56088269 GCTGGCCCACCAGCTAAGAATGG + Intergenic
1140463999 16:75164684-75164706 TGTGACCCACAAGCTAAGAATGG + Intronic
1141636940 16:85318968-85318990 GAGGACCCAGGTGCTAAGAATGG + Intergenic
1141641695 16:85345162-85345184 GATGGCCCATGAGCTAAGAAAGG + Intergenic
1142789509 17:2252877-2252899 TATGACCCATGAGCTAAGAATGG + Intronic
1147041735 17:37724518-37724540 TATGACCCACAAGCTAAGAATGG + Intronic
1149456137 17:56790024-56790046 AAGGAGTCATGAGCTAAGAAAGG + Intergenic
1149959184 17:61088651-61088673 GATGACTCAGAAGCAAGGAAAGG - Intronic
1152334444 17:79692512-79692534 GATGTTTCACGAGCTAGGAGGGG - Intergenic
1155202542 18:23529786-23529808 GATGACTCATATGCTAAGACAGG + Intronic
1155799364 18:30081697-30081719 GATTACTCAAGTGCTAATAATGG + Intergenic
1156281321 18:35641860-35641882 GATGACTCATGAGTTAAGAATGG + Intronic
1158415010 18:57242493-57242515 GATGACTTAGGAGATAAGCAGGG - Intergenic
1158638333 18:59180661-59180683 GAAAACTCAGCAGCTAAGAAAGG - Intergenic
1158701417 18:59751587-59751609 TATGGCCCATGAGCTAAGAATGG - Intergenic
1159801096 18:72900122-72900144 GATGACTGATGAGCAAAGAATGG + Intergenic
1160685710 19:435661-435683 TGTGGCCCACGAGCTAAGAATGG + Intronic
1161750907 19:6095808-6095830 TATGGCCCATGAGCTAAGAATGG + Intronic
1165222128 19:34325126-34325148 GATGACCCAAGAGGAAAGAAAGG - Intronic
1167560309 19:50223098-50223120 GATTACTCACGTGCAGAGAATGG - Exonic
1168069138 19:53939931-53939953 TATGGCCCACCAGCTAAGAATGG - Intronic
1168497781 19:56868759-56868781 TATGGCTCATGAGCTAAGAATGG - Intergenic
926626286 2:15092853-15092875 GGTGACTCACCAGCTCTGAAAGG - Intergenic
929784753 2:44981360-44981382 GATGGCTCACGTGCCAGGAAAGG + Intergenic
930326352 2:49924172-49924194 GGTGTCTCAAGAGCTAAAAAGGG + Intronic
931191288 2:60002742-60002764 TATGGCCCACAAGCTAAGAATGG + Intergenic
933634395 2:84691814-84691836 AATGACCCATGAGATAAGAACGG - Intronic
937662173 2:124444043-124444065 AATGACTCAGGAGCTAACATTGG - Intronic
937882098 2:126876016-126876038 TATGGCCCAGGAGCTAAGAAAGG + Intergenic
946955761 2:224928489-224928511 TATGTCCCATGAGCTAAGAATGG - Intronic
947705134 2:232268683-232268705 TATGACCCATGAGCTAAGACTGG - Intronic
1169798525 20:9492192-9492214 TATGGCTCATGAGATAAGAATGG + Intergenic
1173039292 20:39446031-39446053 CATGGCCCACAAGCTAAGAATGG - Intergenic
1173299828 20:41792378-41792400 TATGACCCACAAGCTAAGAATGG - Intergenic
1173969623 20:47142170-47142192 TATGACTAATGAGTTAAGAATGG - Intronic
1178087291 21:29124656-29124678 TATGACCCAGGAGCTAAGAATGG + Intronic
1178970870 21:37175689-37175711 TATTATTCATGAGCTAAGAATGG + Intronic
1184621762 22:45684441-45684463 TATGACCCATGAGTTAAGAATGG + Intronic
949388511 3:3532848-3532870 TATGACCCACCAGCTGAGAATGG - Intergenic
952141878 3:30488470-30488492 TAAGATTCAGGAGCTAAGAACGG - Intergenic
956130495 3:66048780-66048802 TCTGACTCATGAGCTAAGAATGG + Intergenic
956857816 3:73293258-73293280 TATGGCCCATGAGCTAAGAATGG + Intergenic
957220073 3:77370648-77370670 TATGACTCGTGAGCTAAGAATGG + Intronic
959533043 3:107455387-107455409 TATGACTCAGGAGGCAAGAAAGG - Intergenic
963620576 3:147600330-147600352 GATGAATCACGAGGTCAGGATGG - Intergenic
964329756 3:155589464-155589486 GTGGACTCCTGAGCTAAGAATGG - Intronic
965789203 3:172369597-172369619 GATCACTCACAAGCCAAAAAAGG + Intronic
966885829 3:184377718-184377740 GAGGAATGACCAGCTAAGAATGG + Intronic
967427677 3:189346193-189346215 GATGGCTCGGGAGCTAAGAATGG - Intergenic
967899320 3:194432632-194432654 GAAGACGCAAGAACTAAGAATGG + Intronic
970518937 4:16863299-16863321 GATTATTCACTAGCTAAGAGAGG - Intronic
971540826 4:27814171-27814193 GGTGACTCACCAGTTAAGACAGG - Intergenic
972310869 4:37881080-37881102 TATGACCCATGAGCTAAGAATGG + Intergenic
973904111 4:55509421-55509443 TATGACTCATGAGCTAAGAGTGG - Intronic
974061823 4:57042299-57042321 CATGGCTTATGAGCTAAGAATGG + Intronic
974135733 4:57814919-57814941 TATGACCCATGAGCTCAGAAAGG - Intergenic
975708541 4:77135657-77135679 GATGACACACAAGCTGAGAGGGG - Intergenic
977974388 4:103247141-103247163 TATGGCTCAGGAACTAAGAATGG - Intergenic
978748069 4:112217453-112217475 GATGGCACACAAGCTAAGACTGG - Intergenic
982640839 4:157958107-157958129 CATGGCTCATGAGCTAAAAATGG + Intergenic
987313053 5:16699089-16699111 GATGAAGAAAGAGCTAAGAAAGG + Intronic
989217587 5:38921275-38921297 TATGACCCTTGAGCTAAGAATGG - Intronic
992236753 5:74717699-74717721 TATGTCTCATGGGCTAAGAATGG - Intronic
998842896 5:146275061-146275083 AACGACCCAGGAGCTAAGAATGG - Intronic
999209270 5:149873684-149873706 TATGGCTCATGAGCTAAGGATGG - Intronic
1001249667 5:170137471-170137493 GATGGCCCATGGGCTAAGAATGG - Intergenic
1008091527 6:47298513-47298535 TATTGCTCACAAGCTAAGAATGG + Intronic
1008436272 6:51480194-51480216 GGTGACTCATGAGATAAGATAGG - Intergenic
1011812774 6:91152229-91152251 TGTGACTCTCAAGCTAAGAATGG - Intergenic
1014652576 6:124058678-124058700 TATGACCCTTGAGCTAAGAATGG + Intronic
1015346849 6:132170639-132170661 GATGACTAACAAAGTAAGAAAGG - Intergenic
1016366957 6:143329700-143329722 TATGACTCAAAAGCTAAGAATGG + Intronic
1017107329 6:150900326-150900348 GGTGGCTCAGGAGCTACGAAGGG - Intronic
1022605788 7:31812496-31812518 CATGACCCACAAACTAAGAATGG + Intronic
1026419581 7:70220271-70220293 TATAACCCATGAGCTAAGAATGG - Intronic
1026479801 7:70767870-70767892 GGAGACTCAGGAGCTCAGAATGG + Intronic
1029667442 7:102004956-102004978 TATGGCCCATGAGCTAAGAATGG - Intronic
1029936330 7:104428406-104428428 GATGACTTAAGAGGTAACAAAGG + Intronic
1030426898 7:109389466-109389488 GAGAACTCACCAGCTAAGAGTGG - Intergenic
1032447587 7:131997982-131998004 GATGACCCACCAGCTAAGACTGG - Intergenic
1033334250 7:140438738-140438760 AATGACTCACCAGTAAAGAAAGG + Intergenic
1036156324 8:6345808-6345830 TATGGCCCATGAGCTAAGAACGG - Intergenic
1036480339 8:9133722-9133744 TATGGCCCACGAGCTAAGAACGG + Intergenic
1039032867 8:33328698-33328720 CAAGACTCACCAGCTAATAAAGG - Intergenic
1041274363 8:56142291-56142313 GATCACTAACGAGCTCAGGAGGG + Intergenic
1045032673 8:98152633-98152655 TATGACCCATGAGCTAAGAATGG - Intronic
1046689344 8:117265569-117265591 CATGACTCACTAGCTATGCAAGG - Intergenic
1046729822 8:117712960-117712982 GAAGACTAATGAGGTAAGAAGGG - Intergenic
1047988266 8:130259160-130259182 GATGACTCACTCACTAAGATGGG + Intronic
1050235074 9:3569233-3569255 CATGGCTCAAGAGCTAAAAAAGG + Intergenic
1051135342 9:13914026-13914048 CATGACCCAGGAGCTAAGAATGG - Intergenic
1051475518 9:17503784-17503806 TATGGCCCACAAGCTAAGAATGG + Exonic
1052040261 9:23730450-23730472 TATAACCCATGAGCTAAGAATGG + Intronic
1052849992 9:33372452-33372474 CACAACTCATGAGCTAAGAATGG - Intergenic
1053737833 9:41112782-41112804 GATGACTCCCAATATAAGAAGGG + Intergenic
1054690516 9:68318538-68318560 GATGACTCCCAATATAAGAAGGG - Intergenic
1056208609 9:84343575-84343597 TATGGCCCAAGAGCTAAGAATGG + Intergenic
1057952330 9:99379477-99379499 GGTGACTCTTGAGCTGAGAAGGG - Intergenic
1058468421 9:105251982-105252004 TATGGCTTACGAGCTAAGAATGG + Intronic
1060164552 9:121399411-121399433 GATGAGACATGAGCTAAGTAAGG + Intergenic
1060781860 9:126418858-126418880 GAAGACTCAAGTGCTAGGAAGGG - Intronic
1186343034 X:8663353-8663375 TATGGCTCATGAGCTAAGAATGG - Intronic
1186995354 X:15115635-15115657 TATAACCCATGAGCTAAGAATGG - Intergenic
1187173418 X:16872017-16872039 TATGACCCTCGAGCTGAGAATGG - Intergenic
1188233688 X:27699395-27699417 GATGACTCAGGAGAGAGGAAAGG + Intronic
1188609146 X:32074475-32074497 TATGGCACACAAGCTAAGAATGG + Intronic
1190143087 X:47865247-47865269 GATGACTAACAAGGTAGGAAGGG - Intronic
1195683137 X:107563688-107563710 TATGGCCCAGGAGCTAAGAATGG - Intronic
1196172325 X:112603419-112603441 GATGGCTCAGGAGCCAGGAAAGG - Intergenic
1196627614 X:117894538-117894560 TATGGCTCATGAGCTAAGAATGG + Intergenic
1197771226 X:130090725-130090747 GACGGCCCATGAGCTAAGAATGG + Intronic
1197959551 X:131989283-131989305 AATGGCTGAAGAGCTAAGAAAGG - Intergenic