ID: 1123027350

View in Genome Browser
Species Human (GRCh38)
Location 14:105432953-105432975
Sequence CTTTCGACTGAAGCTCAGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 91}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123027350_1123027355 16 Left 1123027350 14:105432953-105432975 CCCGCCTGAGCTTCAGTCGAAAG 0: 1
1: 0
2: 0
3: 7
4: 91
Right 1123027355 14:105432992-105433014 TAACCCCGTGCTGTAATATAGGG 0: 1
1: 0
2: 0
3: 1
4: 19
1123027350_1123027356 17 Left 1123027350 14:105432953-105432975 CCCGCCTGAGCTTCAGTCGAAAG 0: 1
1: 0
2: 0
3: 7
4: 91
Right 1123027356 14:105432993-105433015 AACCCCGTGCTGTAATATAGGGG 0: 1
1: 0
2: 0
3: 3
4: 30
1123027350_1123027354 15 Left 1123027350 14:105432953-105432975 CCCGCCTGAGCTTCAGTCGAAAG 0: 1
1: 0
2: 0
3: 7
4: 91
Right 1123027354 14:105432991-105433013 GTAACCCCGTGCTGTAATATAGG 0: 1
1: 0
2: 0
3: 1
4: 38

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123027350 Original CRISPR CTTTCGACTGAAGCTCAGGC GGG (reversed) Intronic
901227850 1:7624785-7624807 CTTTCCACTGATCTTCAGGCTGG - Intronic
903400223 1:23038901-23038923 ATTTTGACTGTTGCTCAGGCTGG + Intronic
903744355 1:25576772-25576794 GTTTCCACTGAAGGGCAGGCCGG - Intergenic
906534392 1:46543723-46543745 CTGTCTCCTGGAGCTCAGGCTGG + Intergenic
907936494 1:59046713-59046735 TTTCCCACTGAAGCTCAGGAAGG - Intergenic
911596366 1:99802747-99802769 CTTTGGACTGATACTCAGACTGG - Intergenic
914829288 1:151158964-151158986 CTTTCGCCAGAAGCTGCGGCAGG + Exonic
919756662 1:201070330-201070352 CTTTCAGCTGCAGCTCAGCCAGG + Exonic
924007850 1:239631934-239631956 CTTGCAACTGGAGCTTAGGCAGG + Intronic
1062813018 10:479810-479832 GCGTCGACTGGAGCTCAGGCTGG - Intronic
1062813049 10:479989-480011 GCGTCGACTGGAGCTCAGGCTGG - Intronic
1065440465 10:25748631-25748653 CTTTGGACTTGAACTCAGGCTGG - Intergenic
1067163915 10:43849725-43849747 CTTCTGACGAAAGCTCAGGCCGG - Intergenic
1070831937 10:79423076-79423098 CACTCCACTAAAGCTCAGGCAGG - Intronic
1071384460 10:85105464-85105486 CTTTCTTCTGAAGCTGAGGCAGG - Intergenic
1074110860 10:110421891-110421913 CTCTAGACTGAAGCAGAGGCTGG + Intergenic
1074386656 10:113021853-113021875 CTTTGGACTGAACCAGAGGCTGG + Intronic
1075263215 10:120980242-120980264 GTTTCTGCTGAAGCTCAGGGTGG + Intergenic
1077505270 11:2927232-2927254 TCTTCGCCTAAAGCTCAGGCCGG + Intergenic
1079269894 11:18974452-18974474 CTTTCTACTAAAGGTCAGGATGG - Intergenic
1083651801 11:64208516-64208538 CTGTCTACTGATGCTCAGCCTGG + Intronic
1084593651 11:70104776-70104798 CTTTGGATGGAAGCTCTGGCGGG + Intronic
1088709872 11:112498685-112498707 TTGTCGAGTGCAGCTCAGGCTGG - Intergenic
1098908278 12:76183254-76183276 CTTTCGACACAAGCCCAGGCTGG + Intergenic
1101884893 12:108654066-108654088 CTTTTGACTGAAGCAGAGGTTGG - Intronic
1118709243 14:68506274-68506296 TTAGCGAGTGAAGCTCAGGCAGG + Intronic
1119615678 14:76097316-76097338 CTTTTGCCTGAATCTCAGCCAGG - Intergenic
1121943816 14:98099253-98099275 CTTTTGATTGAAGATGAGGCAGG + Intergenic
1122562262 14:102624474-102624496 TTTTAGACTGATGCCCAGGCTGG - Intronic
1123027350 14:105432953-105432975 CTTTCGACTGAAGCTCAGGCGGG - Intronic
1125495148 15:40186390-40186412 CATTAGACTAAATCTCAGGCTGG - Intronic
1128189468 15:65677955-65677977 TTTTGGTCTGAAGCCCAGGCTGG + Intronic
1128286720 15:66443196-66443218 CTTTCGGCTGTGGCTGAGGCAGG - Intronic
1131652387 15:94414992-94415014 CTGTCCACTGACTCTCAGGCTGG - Intronic
1133779534 16:8927000-8927022 TTTGCAACTGAAGCCCAGGCTGG - Intronic
1133860937 16:9594674-9594696 CATTTGACTGAAACTGAGGCAGG - Intergenic
1137848587 16:51715609-51715631 CTTTAGACTGGAGAACAGGCTGG - Intergenic
1141495263 16:84405372-84405394 CTCATGACTGATGCTCAGGCTGG - Intronic
1143012940 17:3876223-3876245 CTTCCCACTGAAGCTCTGGCCGG + Exonic
1145180646 17:20748540-20748562 ATTACGACTGAACCTCAAGCTGG + Intergenic
1148165864 17:45483573-45483595 CTTTCCCCTGATGCTCAGCCAGG - Intronic
1150712561 17:67544375-67544397 CTTCCCACTGAAGCCCAGGAGGG + Intronic
1151683689 17:75634829-75634851 CTTTCAACTCAGGCTCAGGTGGG + Intronic
1153779030 18:8478245-8478267 CTTTGAGCTGAAGCTCAGCCCGG - Intergenic
1155005919 18:21729054-21729076 ATTTCAACTGCATCTCAGGCAGG + Intronic
1160734143 19:654154-654176 CCTGCCACTGAAGCACAGGCTGG + Intronic
1164682346 19:30144409-30144431 CTTGTGCCTGATGCTCAGGCAGG - Intergenic
1165765931 19:38351215-38351237 CTTTCCAATGAGGCTGAGGCGGG + Intronic
1168374972 19:55869250-55869272 CTCTCGAGGGAAGCTGAGGCTGG + Intronic
926400837 2:12494383-12494405 CTTTGGACTCAGGCTCAGACTGG + Intergenic
927606777 2:24492242-24492264 CTTTCGGCTGAATCCCAGGAAGG - Intronic
928022112 2:27713438-27713460 CTGTGGACTGAAGACCAGGCTGG + Intronic
929788476 2:45008115-45008137 CTTTGGCCTGGAGCTAAGGCTGG + Intronic
1172028862 20:31967991-31968013 CCTTCGGCCGCAGCTCAGGCGGG + Exonic
1173965397 20:47108849-47108871 CTTAAGAATGGAGCTCAGGCTGG - Intronic
1174458495 20:50666417-50666439 GTTTCGCCTGTTGCTCAGGCTGG + Intronic
1175079161 20:56403781-56403803 CTTACGACTGCAGCTGAGACAGG - Exonic
1178390783 21:32196312-32196334 CTTTAGACTGAAACTCAGACTGG + Intergenic
1182814042 22:33142625-33142647 CTGTCCACTGAATCTCAGGAAGG - Intergenic
1183745807 22:39691093-39691115 CTCTCCTCTGAGGCTCAGGCTGG - Intergenic
1184382574 22:44155176-44155198 CTGTGGACAGAAGCTCAGGGAGG - Intronic
1184419958 22:44373965-44373987 CTTTCTACTCAAGCCCTGGCTGG + Intergenic
951728184 3:25783159-25783181 CTGCCCTCTGAAGCTCAGGCCGG + Intronic
962437250 3:135378521-135378543 CTGTAGACTGAAGCTCAGTTTGG + Intergenic
966311399 3:178598116-178598138 CTTGCGACATAAGCTCAGTCAGG + Intronic
968488284 4:875664-875686 CTTTCTACTCAATCACAGGCAGG - Intronic
968570703 4:1338866-1338888 ATTTCGAACGAAGCTAAGGCAGG - Intronic
970966480 4:21934311-21934333 CCTTCAACTCAAGCTCAGGGAGG + Intronic
977667096 4:99654183-99654205 CTTTCGAATTCAGCTCAGGAGGG + Exonic
994282241 5:97919534-97919556 CTTTTGAGTGAAGATCAGTCTGG + Intergenic
995508689 5:112886168-112886190 GTTTTGAATGAAGCGCAGGCAGG - Intronic
998404170 5:141864303-141864325 CTCTCGATCAAAGCTCAGGCTGG + Exonic
998517978 5:142772425-142772447 ATTTTGATTGAACCTCAGGCTGG + Intronic
998554164 5:143106767-143106789 CTTTAAAATGAAGCCCAGGCTGG - Intronic
1001147466 5:169197269-169197291 CTTTCCACTTAAGCTCGAGCAGG + Intronic
1001712032 5:173786692-173786714 CTTTCGAGGGAAGCTCGGGGAGG + Intergenic
1002637356 5:180614939-180614961 CTTGTGAATGGAGCTCAGGCAGG - Intronic
1003940105 6:11015993-11016015 CATTCTACAGAAGCTGAGGCAGG + Intronic
1006013552 6:31062440-31062462 CTTCCTCCTGAAGTTCAGGCTGG + Intergenic
1011713905 6:90084430-90084452 CTTTCAACTCAAGCTTAGGGTGG + Intronic
1013115479 6:107100561-107100583 CTTTCTAATGAAGCTTAGGCTGG - Intronic
1013279567 6:108622964-108622986 GCTTCCACTGAAGCTCAGGAAGG - Intronic
1014694086 6:124596924-124596946 CTTTGGACTTAAACTCAGGCTGG - Intronic
1020072444 7:5236263-5236285 TGTTCACCTGAAGCTCAGGCAGG - Intergenic
1024261772 7:47578820-47578842 TTTTCGAGTGCAGCTCGGGCAGG - Intronic
1026939359 7:74278043-74278065 CTTAAGACTGTAGCTGAGGCGGG + Intergenic
1035195673 7:157218335-157218357 CTTGGGACTGAGGCTGAGGCAGG + Intronic
1035564972 8:635368-635390 CTTTGGAGGGAAGCTCAGGCTGG - Intronic
1037837769 8:22224305-22224327 CTTTCTCCTGAAGCTGAGCCAGG + Exonic
1038238781 8:25788324-25788346 ATTTCGTCTGAAGCTGAGGATGG + Intergenic
1040979310 8:53229383-53229405 CTTTCCACTGAAGATGAGGATGG - Exonic
1044875606 8:96662955-96662977 CTTTGCTCTGTAGCTCAGGCTGG - Intronic
1047296274 8:123573030-123573052 CTCTCGACTGAAGAACATGCTGG + Intergenic
1051663077 9:19443686-19443708 CTTGCTCTTGAAGCTCAGGCTGG + Intronic
1058985194 9:110203474-110203496 CTTTCCTCTGAACCACAGGCTGG - Intronic
1059457936 9:114411593-114411615 CTTTCCAGGGAAGCTCAGGGAGG + Intronic
1060168920 9:121444414-121444436 CTTGCCCCTGAAGCTCAGGGTGG - Intergenic
1060870425 9:127035408-127035430 CTTTCTCCTGAAGATCACGCAGG - Intronic
1186837453 X:13451894-13451916 CTTTATCCAGAAGCTCAGGCTGG + Intergenic