ID: 1123027351

View in Genome Browser
Species Human (GRCh38)
Location 14:105432954-105432976
Sequence GCTTTCGACTGAAGCTCAGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 46
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 41}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123027351_1123027356 16 Left 1123027351 14:105432954-105432976 CCGCCTGAGCTTCAGTCGAAAGC 0: 1
1: 0
2: 1
3: 3
4: 41
Right 1123027356 14:105432993-105433015 AACCCCGTGCTGTAATATAGGGG 0: 1
1: 0
2: 0
3: 3
4: 30
1123027351_1123027354 14 Left 1123027351 14:105432954-105432976 CCGCCTGAGCTTCAGTCGAAAGC 0: 1
1: 0
2: 1
3: 3
4: 41
Right 1123027354 14:105432991-105433013 GTAACCCCGTGCTGTAATATAGG 0: 1
1: 0
2: 0
3: 1
4: 38
1123027351_1123027355 15 Left 1123027351 14:105432954-105432976 CCGCCTGAGCTTCAGTCGAAAGC 0: 1
1: 0
2: 1
3: 3
4: 41
Right 1123027355 14:105432992-105433014 TAACCCCGTGCTGTAATATAGGG 0: 1
1: 0
2: 0
3: 1
4: 19

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123027351 Original CRISPR GCTTTCGACTGAAGCTCAGG CGG (reversed) Intronic
901528006 1:9836130-9836152 GCTTCAGCCTGCAGCTCAGGTGG - Intergenic
903705524 1:25282771-25282793 GGTTCCCACTGAAGCACAGGAGG + Intronic
903721706 1:25410549-25410571 GGTTCCCACTGAAGCACAGGAGG - Intronic
924138017 1:240991399-240991421 GCCCTCTACTGGAGCTCAGGAGG + Intronic
1063342634 10:5282512-5282534 GCTTTGGTCTGGAGCTCAGGGGG - Intergenic
1066258498 10:33705248-33705270 GGCCTGGACTGAAGCTCAGGTGG + Intergenic
1068566298 10:58579233-58579255 GCTTGAAACTGAAGCTCAGTGGG + Intronic
1071027729 10:81136350-81136372 TGTTTTGATTGAAGCTCAGGGGG - Intergenic
1078940245 11:15995255-15995277 GCTTTCCACTGAAACTCCAGAGG + Intronic
1103996363 12:124832974-124832996 GCTTCCTTCTGGAGCTCAGGGGG + Intronic
1117156841 14:52950688-52950710 GCTTTCGGCAGAAACTCGGGAGG + Intronic
1123027351 14:105432954-105432976 GCTTTCGACTGAAGCTCAGGCGG - Intronic
1130745275 15:86646685-86646707 GCTCTGGACTGAAAGTCAGGGGG + Intronic
1143058072 17:4177350-4177372 GCTTGCAGATGAAGCTCAGGAGG - Intronic
1149526163 17:57357432-57357454 GCTGCCGAATGAAGCTCAAGTGG - Intronic
1150712560 17:67544374-67544396 CCTTCCCACTGAAGCCCAGGAGG + Intronic
1151683688 17:75634828-75634850 ACTTTCAACTCAGGCTCAGGTGG + Intronic
1160399672 18:78601016-78601038 GCTTTCAACTGAGGCTCACTTGG + Intergenic
928324647 2:30309848-30309870 GCTGTGGACTGAAGCCAAGGAGG - Intronic
933006974 2:77006801-77006823 GATTTCCACTGAAGCTTAGCTGG - Intronic
944320478 2:198335313-198335335 GGTTTCTACTTATGCTCAGGGGG + Intronic
1183615201 22:38940178-38940200 GCTTTCTCCAGAATCTCAGGTGG + Intergenic
953578017 3:44128735-44128757 GCTTTCCACAGCAGCTAAGGAGG + Intergenic
955883421 3:63572076-63572098 GCTTTGGACTGAAAGTCAAGTGG - Intronic
956586461 3:70870440-70870462 ACTTTTGGCTGAAGTTCAGGAGG + Intergenic
965639116 3:170814260-170814282 GCATGTGACTGAAGTTCAGGAGG + Intronic
968065918 3:195759405-195759427 GCTCTCGACTGACGCACAGCAGG + Intronic
977667095 4:99654182-99654204 GCTTTCGAATTCAGCTCAGGAGG + Exonic
980188262 4:129490350-129490372 GCTTACAAGTGAAGCTCAGCAGG - Intergenic
986494317 5:8327220-8327242 GCTTTGGACTCAAGCAGAGGGGG + Intergenic
987434136 5:17872934-17872956 GTTTTCAGCTGAAGTTCAGGAGG - Intergenic
997706975 5:135964837-135964859 TCTTTCCACTGAAACACAGGAGG - Intergenic
999534343 5:152500985-152501007 GCTTTCCACTGATGCTCTGACGG - Intergenic
1014089715 6:117389868-117389890 CCTTTGGACTGAATCTCATGAGG - Intronic
1025952152 7:66153723-66153745 GATTTCAGCTGAAGCTCAGATGG - Exonic
1026939358 7:74278042-74278064 GCTTAAGACTGTAGCTGAGGCGG + Intergenic
1032547581 7:132756482-132756504 GCTTTACACTGAATCTCTGGCGG - Intergenic
1033246085 7:139717357-139717379 GCTTTCTACTGAAACTCAGGAGG + Intronic
1038800581 8:30745104-30745126 GCTTTGGACAGAAGCTATGGTGG + Intronic
1047237438 8:123054248-123054270 GCATTCAGCTGAAGCTCAGCTGG - Intronic
1049328541 8:142037705-142037727 GCTGTCGACTGAACCTCCTGAGG + Intergenic
1051182462 9:14425632-14425654 GCTATCCACTGAAGCTTAGATGG + Intergenic
1052999539 9:34570038-34570060 TCTTCAGACTGAAGGTCAGGGGG - Intronic
1054821516 9:69525924-69525946 GACTTCGACTGAAGATCAGATGG - Intronic
1058939494 9:109799853-109799875 GCTTTCCACTGAAGCTGGGGAGG - Intronic
1189502347 X:41574671-41574693 TCTTTAGATTTAAGCTCAGGAGG + Intronic