ID: 1123027352

View in Genome Browser
Species Human (GRCh38)
Location 14:105432957-105432979
Sequence ATCGCTTTCGACTGAAGCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 29
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 27}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123027352_1123027354 11 Left 1123027352 14:105432957-105432979 CCTGAGCTTCAGTCGAAAGCGAT 0: 1
1: 0
2: 0
3: 1
4: 27
Right 1123027354 14:105432991-105433013 GTAACCCCGTGCTGTAATATAGG 0: 1
1: 0
2: 0
3: 1
4: 38
1123027352_1123027355 12 Left 1123027352 14:105432957-105432979 CCTGAGCTTCAGTCGAAAGCGAT 0: 1
1: 0
2: 0
3: 1
4: 27
Right 1123027355 14:105432992-105433014 TAACCCCGTGCTGTAATATAGGG 0: 1
1: 0
2: 0
3: 1
4: 19
1123027352_1123027356 13 Left 1123027352 14:105432957-105432979 CCTGAGCTTCAGTCGAAAGCGAT 0: 1
1: 0
2: 0
3: 1
4: 27
Right 1123027356 14:105432993-105433015 AACCCCGTGCTGTAATATAGGGG 0: 1
1: 0
2: 0
3: 3
4: 30

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123027352 Original CRISPR ATCGCTTTCGACTGAAGCTC AGG (reversed) Intronic
905044452 1:34985045-34985067 CTGGCTTTCGACTGAGGCGCAGG - Intronic
908456394 1:64308735-64308757 ATGGCTTTGCTCTGAAGCTCTGG + Intergenic
911384999 1:97163784-97163806 ATCTCTTACTACTGATGCTCTGG + Intronic
915050786 1:153070362-153070384 AGCTCTTTCTGCTGAAGCTCTGG + Exonic
1063342637 10:5282515-5282537 GTCGCTTTGGTCTGGAGCTCAGG - Intergenic
1070427490 10:76303861-76303883 CTCGCTTTCATCTGCAGCTCGGG + Intronic
1074451094 10:113560178-113560200 TTTGCTTTCACCTGAAGCTCAGG - Intronic
1075783642 10:125033394-125033416 CTCGCTTGCTACTAAAGCTCAGG - Intronic
1078325983 11:10381128-10381150 GTTGCTCTTGACTGAAGCTCTGG - Intronic
1103848119 12:123913718-123913740 ATCACTTAAGACTGAAGCCCAGG - Intronic
1123027352 14:105432957-105432979 ATCGCTTTCGACTGAAGCTCAGG - Intronic
1138742668 16:59328966-59328988 ATTGCTTTCATCTGAAGCTGCGG + Intergenic
1150712557 17:67544371-67544393 ATCCCTTCCCACTGAAGCCCAGG + Intronic
1153975628 18:10266367-10266389 ATCTCTTTCGACTTAAGCTTAGG + Intergenic
929315870 2:40477901-40477923 AGCTATTTGGACTGAAGCTCAGG + Intronic
949861791 3:8512119-8512141 ATGGCTTCAGAGTGAAGCTCAGG - Intronic
959944632 3:112113860-112113882 ATTGCTTTGTAGTGAAGCTCTGG + Intronic
983346939 4:166538832-166538854 ATGGCTTTCCCCTGAAGATCAGG + Intergenic
994377249 5:99029127-99029149 ATGACTTTGGACTAAAGCTCAGG + Intergenic
994699418 5:103114435-103114457 ATCACTTCTGTCTGAAGCTCTGG + Intronic
998360744 5:141584555-141584577 ATCTCTTCAGACTGAAGCACTGG + Intronic
1010375173 6:75160356-75160378 ATTGCTTTCACCTGAAACTCAGG - Intronic
1012445468 6:99302809-99302831 ATCACTTTTGAATGTAGCTCTGG - Intronic
1019569406 7:1703757-1703779 TTTGCTTTGGACTGAAACTCAGG - Intronic
1033246084 7:139717354-139717376 GTTGCTTTCTACTGAAACTCAGG + Intronic
1034966098 7:155392095-155392117 ATGGCTTTCCTCGGAAGCTCAGG + Intronic
1041334931 8:56771526-56771548 TTCTCTGTGGACTGAAGCTCTGG - Intergenic
1041444502 8:57935147-57935169 TTCGCTTTTGACTGAATATCTGG + Intergenic
1058939495 9:109799856-109799878 AAGGCTTTCCACTGAAGCTGGGG - Intronic