ID: 1123027354

View in Genome Browser
Species Human (GRCh38)
Location 14:105432991-105433013
Sequence GTAACCCCGTGCTGTAATAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 40
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 38}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123027351_1123027354 14 Left 1123027351 14:105432954-105432976 CCGCCTGAGCTTCAGTCGAAAGC 0: 1
1: 0
2: 1
3: 3
4: 41
Right 1123027354 14:105432991-105433013 GTAACCCCGTGCTGTAATATAGG 0: 1
1: 0
2: 0
3: 1
4: 38
1123027350_1123027354 15 Left 1123027350 14:105432953-105432975 CCCGCCTGAGCTTCAGTCGAAAG 0: 1
1: 0
2: 0
3: 7
4: 91
Right 1123027354 14:105432991-105433013 GTAACCCCGTGCTGTAATATAGG 0: 1
1: 0
2: 0
3: 1
4: 38
1123027352_1123027354 11 Left 1123027352 14:105432957-105432979 CCTGAGCTTCAGTCGAAAGCGAT 0: 1
1: 0
2: 0
3: 1
4: 27
Right 1123027354 14:105432991-105433013 GTAACCCCGTGCTGTAATATAGG 0: 1
1: 0
2: 0
3: 1
4: 38

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123027354 Original CRISPR GTAACCCCGTGCTGTAATAT AGG Intronic
904394237 1:30207441-30207463 GTACCACCATGCTGTTATATGGG + Intergenic
918106036 1:181415932-181415954 AAAACCCAGTGCTGTAGTATTGG - Intronic
918771888 1:188571581-188571603 GTAACCCCCTGTTGTTATACAGG - Intergenic
923303167 1:232662240-232662262 GAACCCCAGTGCTGTAAGATTGG + Intergenic
1073417424 10:103396100-103396122 GTCACCCAGTGACGTAATATTGG - Intronic
1085570020 11:77551073-77551095 GCAGCCCTGGGCTGTAATATGGG - Intronic
1087371445 11:97290236-97290258 GCATGCCCATGCTGTAATATAGG - Intergenic
1093830700 12:23753883-23753905 GTAACCCAGTGCTGTTTTCTAGG + Intronic
1115805102 14:37042076-37042098 GTTACCCCGTAATGTATTATGGG - Intronic
1121389687 14:93563432-93563454 GTACCACCATGCTGTTATATAGG - Intronic
1123027354 14:105432991-105433013 GTAACCCCGTGCTGTAATATAGG + Intronic
1130304833 15:82706357-82706379 GTACCTCCATGCTGTTATATGGG + Intronic
1139632308 16:68237925-68237947 GTGACCCTGTGCTGTAAGAGTGG - Intronic
1144625920 17:16844445-16844467 CTTGCCCCGTGCTGTATTATTGG + Intergenic
1144880513 17:18428275-18428297 CTTGCCCCGTGCTGTATTATTGG - Intergenic
1145151722 17:20516112-20516134 CTTGCCCCGTGCTGTATTATTGG + Intergenic
1146163093 17:30570393-30570415 CTTGCCCCGTGCTGTATTATTGG + Intergenic
1147580070 17:41623143-41623165 CTTGCCCCGTGCTGTATTATTGG + Intronic
1149220832 17:54413916-54413938 GTACCACCATGCTGTTATATGGG + Intergenic
1153881362 18:9424412-9424434 GCACCACCGTGCTGTTATATGGG - Intergenic
1159929454 18:74296172-74296194 GTACCACCATGCTGTTATATGGG + Intergenic
1162049916 19:8026866-8026888 GCAGCCCCTTGCTGTAAAATGGG - Intronic
1163944171 19:20520638-20520660 GCACCCCCATGCTGTTATATAGG - Intergenic
1166236348 19:41459863-41459885 GTAAACCCCTTCTGTGATATTGG - Intergenic
929765191 2:44838289-44838311 GGCACCCCTAGCTGTAATATGGG - Intergenic
933741361 2:85537145-85537167 GTATCCTCGTTCTGTAAAATTGG - Intergenic
942640715 2:178058203-178058225 GTAACCCAGTGCTGGTATTTAGG + Intronic
1168839110 20:897689-897711 GCAGCCCTGGGCTGTAATATGGG - Intronic
1183635312 22:39058599-39058621 GTACCACCATGCTGTTATATGGG - Intronic
963378711 3:144503026-144503048 GGAACCCAGTTCTGAAATATAGG - Intergenic
973751401 4:54023834-54023856 GCACCACCGTGCTGTTATATGGG + Intronic
978294559 4:107189081-107189103 GCAAACCCATGCTGTAATGTTGG + Intronic
981193949 4:141896358-141896380 GGAACCCAGTGCTGTAAGTTTGG + Intergenic
1002597955 5:180336332-180336354 CTAAGCCCGTGCTGTAAAACCGG - Intronic
1018972483 6:168538598-168538620 GTGACCCCCTGCTGGAATCTGGG + Intronic
1029317514 7:99727833-99727855 GCACCACCATGCTGTAATATGGG + Intronic
1037403838 8:18521147-18521169 GTAAGCCCTTGCTATAATAATGG - Intergenic
1051480823 9:17558014-17558036 GTAACAACATGCTGTAATATTGG + Intergenic
1187103483 X:16218500-16218522 GTACCACCATGCTGTTATATGGG - Intergenic
1191825898 X:65364302-65364324 GTACCACCCTGCTGTTATATGGG + Intergenic