ID: 1123027355

View in Genome Browser
Species Human (GRCh38)
Location 14:105432992-105433014
Sequence TAACCCCGTGCTGTAATATA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 21
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 19}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123027351_1123027355 15 Left 1123027351 14:105432954-105432976 CCGCCTGAGCTTCAGTCGAAAGC 0: 1
1: 0
2: 1
3: 3
4: 41
Right 1123027355 14:105432992-105433014 TAACCCCGTGCTGTAATATAGGG 0: 1
1: 0
2: 0
3: 1
4: 19
1123027350_1123027355 16 Left 1123027350 14:105432953-105432975 CCCGCCTGAGCTTCAGTCGAAAG 0: 1
1: 0
2: 0
3: 7
4: 91
Right 1123027355 14:105432992-105433014 TAACCCCGTGCTGTAATATAGGG 0: 1
1: 0
2: 0
3: 1
4: 19
1123027352_1123027355 12 Left 1123027352 14:105432957-105432979 CCTGAGCTTCAGTCGAAAGCGAT 0: 1
1: 0
2: 0
3: 1
4: 27
Right 1123027355 14:105432992-105433014 TAACCCCGTGCTGTAATATAGGG 0: 1
1: 0
2: 0
3: 1
4: 19

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123027355 Original CRISPR TAACCCCGTGCTGTAATATA GGG Intronic
906357161 1:45116207-45116229 AAACTCATTGCTGTAATATACGG - Intronic
919227362 1:194723198-194723220 TTTCCCCTTGCTGTAAAATAGGG - Intergenic
921103323 1:211950596-211950618 TAGCACAGTGCTGTCATATAGGG - Intronic
1065187633 10:23184263-23184285 TAACCCCGTGAGGTAATATTAGG + Intergenic
1076151197 10:128163229-128163251 TAACCTGGTGCTGAGATATAGGG - Intergenic
1093656119 12:21695588-21695610 CAACCCCGAGCTGGAATAAATGG + Intronic
1097641384 12:62186918-62186940 TTATCCTGTGCTGTAATATTAGG - Intronic
1118312930 14:64706151-64706173 TAAACCCGTGCTGGACTATCAGG - Intronic
1123027355 14:105432992-105433014 TAACCCCGTGCTGTAATATAGGG + Intronic
1126960929 15:53993286-53993308 GAACCCCTTGCTTTAATACAGGG - Intergenic
1134399233 16:13893524-13893546 TAACCGCATGCTGTTACATAAGG - Intergenic
1144530278 17:16031921-16031943 TATCCCCTTGCTGTAGTATCTGG - Exonic
934731401 2:96660922-96660944 TAACCCAGGATTGTAATATAAGG - Intergenic
1176865344 21:14048528-14048550 CAACCCCATGCTGTAATCTCTGG - Intergenic
963873288 3:150443212-150443234 TAAACCCTTTCTGTAAAATAGGG + Intronic
984399928 4:179249610-179249632 TGACCACGTACTGTATTATACGG - Intergenic
1002597954 5:180336331-180336353 TAAGCCCGTGCTGTAAAACCGGG - Intronic
1017930354 6:158948361-158948383 TGATTCCATGCTGTAATATAAGG + Intergenic
1040972259 8:53148742-53148764 AAACCCAATGCTTTAATATATGG + Intergenic
1041270034 8:56102653-56102675 TCACCCTTTGCTGTAATATGAGG + Intergenic
1051480824 9:17558015-17558037 TAACAACATGCTGTAATATTGGG + Intergenic