ID: 1123027356

View in Genome Browser
Species Human (GRCh38)
Location 14:105432993-105433015
Sequence AACCCCGTGCTGTAATATAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 34
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 30}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123027351_1123027356 16 Left 1123027351 14:105432954-105432976 CCGCCTGAGCTTCAGTCGAAAGC 0: 1
1: 0
2: 1
3: 3
4: 41
Right 1123027356 14:105432993-105433015 AACCCCGTGCTGTAATATAGGGG 0: 1
1: 0
2: 0
3: 3
4: 30
1123027350_1123027356 17 Left 1123027350 14:105432953-105432975 CCCGCCTGAGCTTCAGTCGAAAG 0: 1
1: 0
2: 0
3: 7
4: 91
Right 1123027356 14:105432993-105433015 AACCCCGTGCTGTAATATAGGGG 0: 1
1: 0
2: 0
3: 3
4: 30
1123027352_1123027356 13 Left 1123027352 14:105432957-105432979 CCTGAGCTTCAGTCGAAAGCGAT 0: 1
1: 0
2: 0
3: 1
4: 27
Right 1123027356 14:105432993-105433015 AACCCCGTGCTGTAATATAGGGG 0: 1
1: 0
2: 0
3: 3
4: 30

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123027356 Original CRISPR AACCCCGTGCTGTAATATAG GGG Intronic
911434576 1:97840302-97840324 AGCCCAGTGCTGTAATATTTTGG + Intronic
923303169 1:232662242-232662264 ACCCCAGTGCTGTAAGATTGGGG + Intergenic
1069363298 10:67669143-67669165 AGCCCACTGCTGTAATTTAGGGG - Intronic
1071983781 10:91030520-91030542 AACCCAGTGCTGTGATTCAGTGG - Intergenic
1074738326 10:116459432-116459454 ATCCCTTTGCTGTGATATAGAGG - Intronic
1082857733 11:57824072-57824094 TACCCAGTGCTGTGATATAAAGG - Intergenic
1093656120 12:21695589-21695611 AACCCCGAGCTGGAATAAATGGG + Intronic
1100626258 12:96335929-96335951 ACCCCTGTACTTTAATATAGAGG - Intronic
1107653719 13:42571052-42571074 AGCCCAGTGCTGGCATATAGTGG + Intronic
1110753168 13:79139591-79139613 ACCCTCCTGCTGTAATAAAGTGG - Intergenic
1112423196 13:99272490-99272512 AAACTCGTGCTGTCATAGAGTGG + Intronic
1123027356 14:105432993-105433015 AACCCCGTGCTGTAATATAGGGG + Intronic
1133139464 16:3733583-3733605 AACTGCGTGCTGCAATATACTGG + Intronic
1151456854 17:74231706-74231728 AGCCCCGTGATGTAAGGTAGTGG + Intronic
1153794711 18:8610780-8610802 AACCCCGTTCTTTAAAATAAAGG + Intronic
1160162498 18:76484470-76484492 AACACCGTGCTCTAAAATGGCGG + Intronic
927945676 2:27133901-27133923 CACCCTGTTCTGTAAAATAGAGG - Intronic
939231780 2:139436084-139436106 AAAACCCTGTTGTAATATAGGGG + Intergenic
942123114 2:172798145-172798167 AAGCCAGTGCTGTACTTTAGAGG - Intronic
942143999 2:173007925-173007947 AAGCCCCTTCTGTAAAATAGGGG + Intronic
949202664 3:1397860-1397882 AACCCCATGCTGTTACTTAGAGG + Intronic
952337211 3:32414313-32414335 AACGCAGTGCTGAAATACAGCGG - Intronic
953075172 3:39563050-39563072 AGCCCCGTGCTGGAAGAGAGTGG - Intergenic
955822531 3:62911330-62911352 AACCCAGTGCTGTAATATTTTGG - Intergenic
982611490 4:157579679-157579701 AAACCCCTGCTGCACTATAGCGG + Intergenic
1006938453 6:37735047-37735069 ATCCCTGTTCTCTAATATAGAGG - Intergenic
1015731876 6:136357365-136357387 AACCCTGTCCTGTATTTTAGAGG - Intronic
1018816065 6:167332222-167332244 AACCCCGTGCTGTAACAAACAGG - Intronic
1020366287 7:7384206-7384228 AACCCAGTGCAGTAACATACTGG + Intronic
1029484459 7:100830933-100830955 ACCCACGTTCTGTAATTTAGTGG - Intronic
1031388150 7:121178431-121178453 AACTCTGTGCTGTAATGTAGAGG + Intronic
1039997125 8:42543035-42543057 AACCCCTAGTTGTAATATATTGG + Intronic
1045758702 8:105576147-105576169 TACCGTGTGCTGTAAGATAGTGG - Intronic
1048398787 8:134043255-134043277 AACCCCCTGCTTTAATAATGTGG + Intergenic