ID: 1123027356

View in Genome Browser
Species Human (GRCh38)
Location 14:105432993-105433015
Sequence AACCCCGTGCTGTAATATAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 34
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 30}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123027351_1123027356 16 Left 1123027351 14:105432954-105432976 CCGCCTGAGCTTCAGTCGAAAGC 0: 1
1: 0
2: 1
3: 3
4: 41
Right 1123027356 14:105432993-105433015 AACCCCGTGCTGTAATATAGGGG 0: 1
1: 0
2: 0
3: 3
4: 30
1123027350_1123027356 17 Left 1123027350 14:105432953-105432975 CCCGCCTGAGCTTCAGTCGAAAG 0: 1
1: 0
2: 0
3: 7
4: 91
Right 1123027356 14:105432993-105433015 AACCCCGTGCTGTAATATAGGGG 0: 1
1: 0
2: 0
3: 3
4: 30
1123027352_1123027356 13 Left 1123027352 14:105432957-105432979 CCTGAGCTTCAGTCGAAAGCGAT 0: 1
1: 0
2: 0
3: 1
4: 27
Right 1123027356 14:105432993-105433015 AACCCCGTGCTGTAATATAGGGG 0: 1
1: 0
2: 0
3: 3
4: 30

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123027356 Original CRISPR AACCCCGTGCTGTAATATAG GGG Intronic