ID: 1123031534

View in Genome Browser
Species Human (GRCh38)
Location 14:105454071-105454093
Sequence ATGTCGCCCCACAAGAGCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 58
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 52}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123031529_1123031534 -10 Left 1123031529 14:105454058-105454080 CCCTCCTGCGCCCATGTCGCCCC 0: 1
1: 0
2: 1
3: 8
4: 175
Right 1123031534 14:105454071-105454093 ATGTCGCCCCACAAGAGCTCTGG 0: 1
1: 0
2: 0
3: 5
4: 52
1123031528_1123031534 -7 Left 1123031528 14:105454055-105454077 CCTCCCTCCTGCGCCCATGTCGC 0: 1
1: 0
2: 0
3: 11
4: 163
Right 1123031534 14:105454071-105454093 ATGTCGCCCCACAAGAGCTCTGG 0: 1
1: 0
2: 0
3: 5
4: 52
1123031523_1123031534 22 Left 1123031523 14:105454026-105454048 CCGGGAGCTGTGGGGGCTCCTGC 0: 1
1: 1
2: 1
3: 59
4: 504
Right 1123031534 14:105454071-105454093 ATGTCGCCCCACAAGAGCTCTGG 0: 1
1: 0
2: 0
3: 5
4: 52
1123031524_1123031534 4 Left 1123031524 14:105454044-105454066 CCTGCGCCCTCCCTCCCTCCTGC 0: 1
1: 2
2: 21
3: 336
4: 2546
Right 1123031534 14:105454071-105454093 ATGTCGCCCCACAAGAGCTCTGG 0: 1
1: 0
2: 0
3: 5
4: 52
1123031526_1123031534 -3 Left 1123031526 14:105454051-105454073 CCTCCCTCCCTCCTGCGCCCATG 0: 1
1: 0
2: 3
3: 81
4: 937
Right 1123031534 14:105454071-105454093 ATGTCGCCCCACAAGAGCTCTGG 0: 1
1: 0
2: 0
3: 5
4: 52
1123031525_1123031534 -2 Left 1123031525 14:105454050-105454072 CCCTCCCTCCCTCCTGCGCCCAT 0: 1
1: 0
2: 4
3: 176
4: 1991
Right 1123031534 14:105454071-105454093 ATGTCGCCCCACAAGAGCTCTGG 0: 1
1: 0
2: 0
3: 5
4: 52
1123031527_1123031534 -6 Left 1123031527 14:105454054-105454076 CCCTCCCTCCTGCGCCCATGTCG 0: 1
1: 0
2: 0
3: 7
4: 162
Right 1123031534 14:105454071-105454093 ATGTCGCCCCACAAGAGCTCTGG 0: 1
1: 0
2: 0
3: 5
4: 52

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123031534 Original CRISPR ATGTCGCCCCACAAGAGCTC TGG Intronic
901680472 1:10910050-10910072 AAGTTGCCCCAGAAGGGCTCAGG - Intergenic
904474621 1:30757009-30757031 AAGTTGCCCAACAAGAGCTTGGG + Intronic
904746939 1:32717205-32717227 ATGTGGACTCACAAAAGCTCAGG - Intergenic
909478531 1:76109701-76109723 AGGGCACCACACAAGAGCTCGGG + Intronic
1069878297 10:71576440-71576462 AGCTTGCCCCACAAGAGCGCAGG + Intronic
1074904961 10:117853365-117853387 ATTTTGCCCCACATGACCTCGGG + Intergenic
1078222441 11:9363241-9363263 ATCTCCCCTCACCAGAGCTCTGG + Intergenic
1083036852 11:59646117-59646139 TTGTTTCCACACAAGAGCTCTGG + Intronic
1088513156 11:110599025-110599047 CTGTCCCCACACAAGAGCACAGG - Intronic
1103789310 12:123458292-123458314 ATGGCGCCCCACACAAGCGCGGG - Intronic
1108623353 13:52205012-52205034 CTGTTGCCCCCCTAGAGCTCTGG - Intergenic
1109243106 13:59916220-59916242 ATGGCACCCGAAAAGAGCTCAGG + Exonic
1110284656 13:73735441-73735463 ATGTCGCCCCCTAGGGGCTCTGG + Intronic
1116814005 14:49566856-49566878 ATGTCACCGCACTAGAGCCCGGG + Intergenic
1118059264 14:62117270-62117292 ATGACGCCCCTCCACAGCTCGGG - Intergenic
1118090094 14:62464966-62464988 ATGCTGACCCACAAGAGCTCTGG - Intergenic
1123031534 14:105454071-105454093 ATGTCGCCCCACAAGAGCTCTGG + Intronic
1126558145 15:50013301-50013323 ATGTCCCCCTAGAAGAGCTATGG - Intronic
1132891375 16:2206437-2206459 AGGTCGACCCACCAGAGCTCAGG - Intronic
1135916967 16:26613987-26614009 ATGTCACCCCACAAGGGCAGAGG + Intergenic
1138576734 16:57912180-57912202 ATGTCGCCCCAGGAGAGATGTGG + Intronic
1142271419 16:89091559-89091581 ATGTGGCCCCAGAGGAGCTCAGG - Intronic
1150297428 17:64020359-64020381 ATGTCGAGCCACAGGAGCGCTGG + Intronic
1150875177 17:68962954-68962976 ATGTCAGCCCTCAAGATCTCAGG + Intergenic
1155358470 18:24977193-24977215 CTGTCTCCCCACCAGAGCTCAGG - Intergenic
1156382119 18:36572720-36572742 AGGCCTCCCCCCAAGAGCTCAGG - Intronic
1162548574 19:11345821-11345843 ATGTCAGCCCTCAAGATCTCAGG + Exonic
1163580328 19:18135013-18135035 CTGCAGCCCCACCAGAGCTCTGG + Intronic
1164938321 19:32231849-32231871 ATGTGGCCCCAACAGAGCCCCGG + Intergenic
930468909 2:51789226-51789248 ATTCAGCCCCACTAGAGCTCTGG - Intergenic
932126912 2:69152888-69152910 ATGTCTCCCCAGAATAGCTTAGG + Intronic
934608981 2:95720624-95720646 ATTTTGGCCCACAAGAGTTCAGG + Intergenic
937115612 2:119403064-119403086 ATGACTCCCCACAAGAACACAGG + Intergenic
943354166 2:186831244-186831266 TTTACGCCCCACAAGAGCTCTGG + Intronic
948024122 2:234763451-234763473 AGGGAGCCCCACAAGACCTCAGG + Intergenic
1169076542 20:2763312-2763334 ATGTAGCCCCAGAAGCTCTCTGG - Intergenic
1170897492 20:20428986-20429008 ATGTTGCCCCAACAGAACTCAGG - Intronic
1171461491 20:25300577-25300599 AAGTCTCCCAACAAGATCTCAGG + Intronic
1172535880 20:35672865-35672887 ATGGCTCCCCATCAGAGCTCTGG + Intronic
1179408223 21:41142681-41142703 ATCTCGCCCCTCCAGAGCCCAGG + Intergenic
1184768882 22:46586638-46586660 ATTCCGCCACACCAGAGCTCTGG - Intronic
1185047486 22:48536266-48536288 ATGTTGCCCCACAAAAACCCGGG - Intronic
956014781 3:64870848-64870870 GTGTCACTCCACTAGAGCTCTGG + Intergenic
960358193 3:116678874-116678896 TGGACGCCCAACAAGAGCTCAGG + Intronic
975440124 4:74400492-74400514 ATCTCGGCCAACAGGAGCTCTGG + Intergenic
987251777 5:16108010-16108032 ATGACGCTGGACAAGAGCTCAGG + Intronic
988520230 5:31939110-31939132 ATGGCGCCCCACCAGAGGTAGGG + Intronic
989244032 5:39233257-39233279 ATGTAGCCCCCAAAGAGCTGTGG + Intronic
991980201 5:72222384-72222406 ATTTCTCCTCGCAAGAGCTCTGG - Intronic
991992138 5:72350350-72350372 ATGTCTCCCCACAGGAACTGGGG - Intronic
999586376 5:153094029-153094051 ATCCAGCCCCACAAGAGGTCAGG - Intergenic
1024594558 7:50921154-50921176 ATGACCCCCTACAAGAGATCGGG - Intergenic
1025715703 7:63953495-63953517 ATGTCTCCCCAGGAGAGCTGGGG + Intergenic
1036714006 8:11103383-11103405 ATCAGGCCCCACAAGAACTCAGG + Intronic
1041426814 8:57730505-57730527 ATGCTTCCCCCCAAGAGCTCTGG + Intergenic
1191655061 X:63586903-63586925 ATGTTGAACCACAACAGCTCTGG - Intergenic
1192314222 X:70039514-70039536 ATGACGCCACACATGAGCTAGGG + Intergenic
1197297993 X:124742760-124742782 ATATTGCCTCATAAGAGCTCAGG - Intronic