ID: 1123033395

View in Genome Browser
Species Human (GRCh38)
Location 14:105461649-105461671
Sequence GTCTCCAGCCTCTGCTGCGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 261
Summary {0: 1, 1: 1, 2: 4, 3: 25, 4: 230}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123033395_1123033399 8 Left 1123033395 14:105461649-105461671 CCAGCGCAGCAGAGGCTGGAGAC 0: 1
1: 1
2: 4
3: 25
4: 230
Right 1123033399 14:105461680-105461702 AATTCGGAAGAAACAAACATGGG 0: 1
1: 0
2: 0
3: 15
4: 230
1123033395_1123033402 14 Left 1123033395 14:105461649-105461671 CCAGCGCAGCAGAGGCTGGAGAC 0: 1
1: 1
2: 4
3: 25
4: 230
Right 1123033402 14:105461686-105461708 GAAGAAACAAACATGGGGTTGGG 0: 1
1: 0
2: 3
3: 35
4: 367
1123033395_1123033401 13 Left 1123033395 14:105461649-105461671 CCAGCGCAGCAGAGGCTGGAGAC 0: 1
1: 1
2: 4
3: 25
4: 230
Right 1123033401 14:105461685-105461707 GGAAGAAACAAACATGGGGTTGG 0: 1
1: 0
2: 5
3: 47
4: 374
1123033395_1123033403 18 Left 1123033395 14:105461649-105461671 CCAGCGCAGCAGAGGCTGGAGAC 0: 1
1: 1
2: 4
3: 25
4: 230
Right 1123033403 14:105461690-105461712 AAACAAACATGGGGTTGGGTAGG 0: 1
1: 0
2: 4
3: 25
4: 349
1123033395_1123033397 -8 Left 1123033395 14:105461649-105461671 CCAGCGCAGCAGAGGCTGGAGAC 0: 1
1: 1
2: 4
3: 25
4: 230
Right 1123033397 14:105461664-105461686 CTGGAGACGCATCTGGAATTCGG 0: 1
1: 0
2: 1
3: 5
4: 108
1123033395_1123033398 7 Left 1123033395 14:105461649-105461671 CCAGCGCAGCAGAGGCTGGAGAC 0: 1
1: 1
2: 4
3: 25
4: 230
Right 1123033398 14:105461679-105461701 GAATTCGGAAGAAACAAACATGG 0: 1
1: 0
2: 2
3: 21
4: 237
1123033395_1123033404 19 Left 1123033395 14:105461649-105461671 CCAGCGCAGCAGAGGCTGGAGAC 0: 1
1: 1
2: 4
3: 25
4: 230
Right 1123033404 14:105461691-105461713 AACAAACATGGGGTTGGGTAGGG 0: 1
1: 0
2: 2
3: 30
4: 335
1123033395_1123033400 9 Left 1123033395 14:105461649-105461671 CCAGCGCAGCAGAGGCTGGAGAC 0: 1
1: 1
2: 4
3: 25
4: 230
Right 1123033400 14:105461681-105461703 ATTCGGAAGAAACAAACATGGGG 0: 1
1: 0
2: 0
3: 12
4: 191

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123033395 Original CRISPR GTCTCCAGCCTCTGCTGCGC TGG (reversed) Intronic
900534220 1:3169083-3169105 GTCTCCAGCCTCTACTTGGAAGG + Intronic
900600211 1:3499614-3499636 GGCTCCTGCCTCTGCCCCGCTGG - Exonic
901031414 1:6309123-6309145 GTCTCCAGCCTCGGCAGCAGAGG + Intronic
901047354 1:6405220-6405242 GGCTCCGGCCTCTGCTGGGTGGG - Intergenic
901313795 1:8291477-8291499 CGCTGCAGCCTCTGCTGCCCGGG + Intergenic
901380553 1:8870883-8870905 TTCTTCATCCTCTGCTGGGCAGG - Intronic
903088812 1:20890529-20890551 GTCTCCAACCTCTGTTTCCCAGG + Intronic
905237433 1:36559887-36559909 GTCCCCAGCCTCTTCTGTGATGG + Intergenic
905945636 1:41899480-41899502 CACTGCAGCCTCTGCTGCCCGGG + Intronic
906091816 1:43186001-43186023 TTCTACAACCTCTGCTGCCCGGG - Intronic
908274338 1:62454057-62454079 CACTCCAACCTCTGCTGCCCGGG + Intergenic
908854867 1:68414964-68414986 GTCTCCTCACTCTGCTGCCCAGG - Intergenic
911718929 1:101168740-101168762 CACTGCAGCCTCTGCTGCCCAGG + Intergenic
911744030 1:101419385-101419407 GTCTCCCACCTCAGCTGCTCAGG - Intergenic
912274066 1:108238445-108238467 TTCTCCCGCCTCTGCTGCCTGGG + Intronic
912287201 1:108381417-108381439 TTCTCCCGCCTCTGCTGCCTGGG - Intronic
912294153 1:108455878-108455900 TTCTCCCGCCTCTGCTGCCTGGG - Intronic
913088720 1:115461587-115461609 GCCTCCAGCCTCTTCTTTGCGGG - Intergenic
913271181 1:117095028-117095050 TGCTCCAGCCTCTGCTTCTCTGG - Intronic
913445997 1:118951478-118951500 ATCTCCTGCCTCTCCTGCCCTGG - Intronic
913705586 1:121419011-121419033 GTCTGCAACCTCTGCTTCCCGGG + Intergenic
914944453 1:152051595-152051617 AACTCCAGCCTTTGCTGAGCGGG - Intergenic
915147029 1:153801400-153801422 CTCTGCAGCCCCTGCTGCCCTGG + Intergenic
915274012 1:154775691-154775713 GTCTCCAGCTGGTGCTGTGCTGG - Intronic
915524350 1:156466932-156466954 GTCTCCAGCCTCAGATTCCCAGG + Exonic
924681995 1:246245365-246245387 GACTGCAGCCTCTGCTTCCCAGG - Intronic
1067947920 10:50702336-50702358 GTGTCCAGCTGCTGCTGGGCTGG + Intergenic
1067972799 10:50991683-50991705 GCCCCCAGCCTCTGCGCCGCGGG - Intronic
1069874696 10:71554559-71554581 GCCTCCAGCCCCTGCAGCCCTGG + Intronic
1070918302 10:80168912-80168934 GTCTCCAGCCTTTGGGGCCCAGG + Intronic
1071255829 10:83870716-83870738 GGCTCCAGGCTGTGCTGGGCTGG - Intergenic
1073818643 10:107235155-107235177 GTCTCTATCCTCTCCTGCCCTGG + Intergenic
1076854637 10:133109799-133109821 GCCTCCAGGCTCAGCTGGGCTGG + Intronic
1077246466 11:1541682-1541704 TTCTCCAGGCTCTGCAGCGTAGG - Intergenic
1077487593 11:2846158-2846180 GTCTGCACCCTAGGCTGCGCCGG - Intronic
1078299043 11:10106551-10106573 CACTGCAACCTCTGCTGCGCGGG - Intronic
1080223559 11:29934464-29934486 TGCCCCAGCCTCTGCGGCGCCGG + Intergenic
1081573630 11:44306335-44306357 GCCTCCAGTCTCTGCTGGCCGGG - Intronic
1082006386 11:47421530-47421552 GTCCCCAGCCTCCCCTGCTCTGG - Intronic
1083616425 11:64028712-64028734 GCCCCCAGCCTCAGCGGCGCTGG + Intronic
1083801032 11:65046392-65046414 GTCTTCAGCCTCTCCTGTCCTGG + Intronic
1083953996 11:65972640-65972662 GTCTGAAGCCTCAGCTACGCCGG + Intronic
1084434517 11:69131178-69131200 GTCCCCAACCTCTGCTGTCCCGG + Intergenic
1084546677 11:69818338-69818360 GGCTCCAGGCTCTGCTGCTTTGG - Intronic
1088706765 11:112470952-112470974 GGCTCCAGCTCCTGCTGGGCAGG + Intergenic
1089571022 11:119409868-119409890 GTCTGAAGCCTCAGCTGAGCTGG + Intergenic
1089660973 11:119985033-119985055 GTCTCCAGCCTAGGGTGGGCTGG + Intergenic
1090035945 11:123249646-123249668 GTCTGCAGCCCCAGCTGCTCAGG + Intergenic
1092160447 12:6312678-6312700 GGCTCCCGCCTCTGCTTGGCAGG + Intronic
1096698198 12:53364432-53364454 GACTGCAACCTCTGCTGCCCAGG + Intergenic
1098284464 12:68893725-68893747 GACTCCAACTTCTGCTGCACTGG + Intronic
1099445773 12:82749843-82749865 TTCTCCTGCCTCTGCTTCCCAGG + Intronic
1100484054 12:95007822-95007844 TTCTCCAGCCTCAGCTTCACAGG - Intergenic
1101757962 12:107635925-107635947 GCATCCAGCCTCTGCCGCTCAGG - Intronic
1102698994 12:114823018-114823040 TTCTCCTGCCTCAGCTTCGCAGG + Intergenic
1103347491 12:120260889-120260911 GTCTGCAGCCTCTGCCTCCCAGG - Intronic
1103560681 12:121791986-121792008 GTCTCTAGCCCCTGGTGAGCTGG - Intronic
1103592840 12:122004445-122004467 GGCCCCGGCCTCTGCTGGGCGGG - Intergenic
1104131728 12:125900253-125900275 GTATCCTGTCTCTGCTGCTCAGG - Intergenic
1105389263 13:19959354-19959376 GGCTGCTGCCTCTGCTCCGCCGG + Intronic
1105593920 13:21818185-21818207 GTCCCCAGCCCCTGCCCCGCAGG - Intergenic
1105944201 13:25175792-25175814 GCCTCCAGCCTCAGCTTCCCAGG - Intergenic
1106405786 13:29471715-29471737 TGCTCCAGCCTCTGCTCTGCAGG + Intronic
1111447582 13:88369198-88369220 GTCTCCAGGCTCTTCTCAGCAGG - Intergenic
1112272857 13:97986030-97986052 GTCTCCAGCTTCTGGGGCTCAGG - Intronic
1112282409 13:98074391-98074413 AACTCCAGCCTCTGTTGCCCAGG - Intergenic
1113643351 13:111973928-111973950 GTCAGCAGCCACTGCTGCCCGGG + Intergenic
1113697191 13:112354826-112354848 CTCTCCTGCCTCTCATGCGCAGG + Intergenic
1113954307 13:114089033-114089055 CTCGCCAGGCTCTGCTGCCCTGG - Intronic
1114614481 14:24060975-24060997 GATTCCAGCCTCTGCCGCACAGG - Exonic
1118737279 14:68711021-68711043 GTCTCCATCCTGGGCAGCGCTGG + Intronic
1118807389 14:69250111-69250133 GGCTCCAGCCTTTTCTGGGCAGG + Intergenic
1120691853 14:87601537-87601559 GTCTCCAGTCACTGCTTAGCCGG - Intergenic
1122157624 14:99759714-99759736 GTCTCCAGCCTGTGCTGCGCAGG + Intronic
1122491056 14:102116575-102116597 GCCTGGAGCCTCTGCTGCTCTGG + Intronic
1122599986 14:102916475-102916497 TTCCTCAGCCTCTGCGGCGCCGG + Intergenic
1123033395 14:105461649-105461671 GTCTCCAGCCTCTGCTGCGCTGG - Intronic
1123117509 14:105901341-105901363 GTCTCCAGCCTCTGCAGGTCGGG - Intergenic
1123738971 15:23216469-23216491 CCTTCCAGCCTCTGCTGAGCTGG + Intergenic
1124290191 15:28445439-28445461 CCTTCCAGCCTCTGCTGAGCTGG + Intergenic
1124293047 15:28472129-28472151 CCTTCCAGCCTCTGCTGAGCTGG - Intergenic
1124914846 15:33959705-33959727 GTCTCCAGCATTTGCTGAGAAGG - Intronic
1125252434 15:37720831-37720853 GTCTTCAGCCTCTGCCTCTCTGG + Intergenic
1125832302 15:42725619-42725641 CTCTCCAGCCTGTACTGTGCCGG + Exonic
1128206186 15:65854357-65854379 CACTGCAGCCTCTGCTGCCCGGG - Intronic
1129113595 15:73352618-73352640 GTTTCCAGCCTGAGCTGTGCAGG + Intronic
1130326083 15:82881283-82881305 GTCTCCAGTCTCACCTGCTCTGG + Intronic
1130767401 15:86884734-86884756 CACTCCAGCCTCTGCTTCCCAGG - Intronic
1131085998 15:89575961-89575983 GTCTCCTCCCGCTGCTCCGCAGG - Exonic
1132175966 15:99714921-99714943 GTTTGCAGCCTGTGGTGCGCAGG - Exonic
1132729648 16:1355118-1355140 GTCTCCCGCCTCTGCGGGGTCGG + Intronic
1132788078 16:1669199-1669221 GACCCCAGCCCCTGCTGCCCTGG - Intronic
1135047636 16:19168256-19168278 GTCTCCGGCCCCGCCTGCGCTGG + Exonic
1135604265 16:23809535-23809557 TTCTCCAGCCTCTGCTTTCCTGG + Intergenic
1135636254 16:24078219-24078241 GTCTGCAGCCGCTGCAGCGTGGG + Intronic
1136927706 16:34389380-34389402 GTCTCCAGCTCCTGCGGTGCTGG + Intergenic
1136976868 16:35022426-35022448 GTCTCCAGCTCCTGCGGTGCTGG - Exonic
1137520534 16:49191413-49191435 GTCTCCAGCATCTGGTTCACAGG - Intergenic
1138537634 16:57668275-57668297 GGCCCCAGGCTCTGCTGAGCTGG - Exonic
1138741111 16:59311528-59311550 GACTGCAGCCTCTGCTTCCCAGG - Intergenic
1141584941 16:85027704-85027726 GCCTCCAGCCCCTTCTGCGCAGG - Intergenic
1142733273 17:1877652-1877674 GTTTCCAGCTTCTCCTGCCCAGG - Intronic
1144478784 17:15612022-15612044 GGATCCAGCATCTGCTGCTCAGG - Intronic
1144556517 17:16287123-16287145 TTCTCCAGCCATGGCTGCGCAGG + Intronic
1144592391 17:16535778-16535800 GTCCACAGCCTCCGCTGCGCAGG - Intergenic
1144919518 17:18751711-18751733 GGCTCCAGCATCTGCTGCTCAGG + Intronic
1144955621 17:19017534-19017556 TCCTCCAGCCTCTGCTCAGCTGG - Intronic
1146062286 17:29613661-29613683 GTCTCCAGCCGCCGCTCTGCAGG - Exonic
1147015780 17:37490145-37490167 GTCTCGGGCCTCTCCTCCGCGGG - Intronic
1148002502 17:44398029-44398051 CTTTCCAGCCTCAGCTGCCCTGG - Exonic
1148338134 17:46855193-46855215 CTCTGCAGCCACTGCTGCCCTGG - Intronic
1148847749 17:50539107-50539129 GACTCCAGCCTCTGGTGCACAGG + Intronic
1151539624 17:74758420-74758442 GTCTCCAGCCTGTCCAGCCCTGG + Intronic
1152725376 17:81942383-81942405 GTCTCCATGCTCTGCTCCTCTGG - Intronic
1154000198 18:10476110-10476132 GGTTCCAGCCTCTCCTGGGCAGG - Intronic
1154010334 18:10568718-10568740 GGCTCCAGCAGCTGCTGCCCAGG + Intergenic
1157490815 18:48122560-48122582 CTCACCAGCCTCAGCTGCTCTGG - Intronic
1158534625 18:58296555-58296577 GGCTCCAGCCTCTGCCGCTGGGG + Intronic
1161977685 19:7615475-7615497 GACTCCAGCCCCTGCTGCCCGGG + Exonic
1162557667 19:11397503-11397525 GCCTCCGAGCTCTGCTGCGCCGG + Exonic
1162682403 19:12355923-12355945 CTCTGCAGCCTCTGCTTCCCTGG - Intronic
1166517915 19:43461202-43461224 ATCCCCAGCTTCTGCTGCGCTGG - Exonic
1166563045 19:43746063-43746085 TTCTCCAGCCTCAGCTTCCCAGG - Intronic
1166851840 19:45765031-45765053 GTCTCCAGTCTCAGGGGCGCGGG + Exonic
1167825271 19:51967196-51967218 GCCTCCAGCCTCTGGTCTGCTGG - Intronic
1168173708 19:54607964-54607986 TTCTCCAGCCCCAGCTGCCCGGG - Intronic
1168320367 19:55505810-55505832 CACTGCAGCCTCTGCTGCCCAGG + Intronic
1168406813 19:56114781-56114803 GTGTCCAGCACCTGCTGCCCTGG + Intronic
925367973 2:3324228-3324250 GTCCCCAGCCCCTGGAGCGCAGG + Intronic
928331125 2:30358692-30358714 GCCTCCACCCTCTCCTGCACTGG - Intergenic
928397697 2:30955627-30955649 GGCTCCAGCCTCTGTTGCACAGG - Exonic
931894721 2:66716312-66716334 ATGTCCTGCCTCTGCTGCGCTGG + Intergenic
936516824 2:113186198-113186220 GTCTCCAGTCTCTGCAGGCCTGG - Exonic
938109879 2:128556813-128556835 GTCTGCAGGCTGTGCTGGGCTGG - Intergenic
947492911 2:230611253-230611275 CCCTCCACCCTCTGCTGCCCTGG + Intergenic
947751267 2:232533968-232533990 GGGTCCATCCTCTGCTGGGCGGG - Exonic
948266521 2:236638941-236638963 GTCTCCAGCCCGGGCTGCACAGG - Intergenic
948473522 2:238202494-238202516 GTCTCCAGCCCCCGCTGGGTTGG + Intronic
948560182 2:238847130-238847152 GGGCCCAGCCTCCGCTGCGCTGG - Intergenic
948648654 2:239424998-239425020 GTCCCCAGCCCTTGCTGCCCTGG - Intergenic
1169171715 20:3470887-3470909 GTCTCCGGCGTCCGCGGCGCCGG - Intergenic
1169467418 20:5853739-5853761 GTCCCCTGCCTCTGTTGCTCAGG + Intronic
1170711016 20:18791094-18791116 TTCTCCTGCCTCTGCTGCAAAGG - Intergenic
1170975630 20:21161405-21161427 GACTGCAGCCTCTGCTGCCCGGG + Intronic
1171085546 20:22235301-22235323 GTCTGCAGCCTCTGCTACCCAGG + Intergenic
1172268323 20:33636837-33636859 GGCTCCTGCCTCTCCTGCTCTGG + Intronic
1172697635 20:36833462-36833484 GCCTCCAGCCCCTGCTCCCCAGG + Intronic
1173609327 20:44355439-44355461 CTCTCCAGCCCCTTCTGCTCCGG + Intergenic
1174059402 20:47821837-47821859 TGCTCCAGCCTCTGCTGCTCTGG - Intergenic
1174186092 20:48707298-48707320 CTCTCCAGCCTCGGCTGGGCAGG + Intronic
1174272816 20:49381790-49381812 GGCTCCTGCCTCTGCTCCCCGGG - Intronic
1175806482 20:61831945-61831967 GGCTCCAGCCGCTCCTGCCCAGG - Intronic
1176104516 20:63379646-63379668 CACACCAGCCTCTGCTGCCCTGG + Intergenic
1178317762 21:31581039-31581061 CTCTCCAGCCTCAGCTTCCCAGG - Intergenic
1178597662 21:33969280-33969302 GTAGCCAGTCTCTGCTGAGCTGG - Intergenic
1180869861 22:19140011-19140033 CTCTCCAGCCTCTCCTGCTTAGG + Exonic
1181178614 22:21052152-21052174 GTGCCGAGCCTCTGCTGGGCAGG - Intronic
1181678387 22:24472957-24472979 GTCTCCTCCCTCTGTTGCCCAGG - Intergenic
1182186488 22:28408464-28408486 CACTGCAACCTCTGCTGCGCAGG + Intronic
1182520775 22:30883436-30883458 GTCTCCAGGCTCTGCTGAGCTGG - Intronic
1182888875 22:33799546-33799568 TTCTCCTGCCTCAGCTGCCCAGG + Intronic
1183630262 22:39028321-39028343 CTGTCCAGCCTCTGCATCGCAGG - Intronic
1183936095 22:41263217-41263239 GTTTCCAGGCACTGCTGGGCAGG + Intronic
1183942104 22:41301797-41301819 GTCCCCGGCCTCTGCCCCGCGGG - Intronic
1183958401 22:41396304-41396326 GTCTCCAGCCTGGGCTGCCGAGG + Exonic
1184854084 22:47136953-47136975 GTCGCCAGCCCATGCTGTGCAGG + Intronic
1185182230 22:49369993-49370015 GTCTCCAACTTCTGCAGCCCTGG - Intergenic
949504547 3:4714610-4714632 CTCTCCAGCCTCTCCTGAGGTGG + Intronic
950459183 3:13111102-13111124 CTCTCCAGCCTCTGCAGGGCAGG - Intergenic
958948628 3:100393098-100393120 TACTGCAGCCTCTGCTGCCCGGG - Intronic
961718971 3:128879548-128879570 CTCTCCATCCCCTGCTGCGGGGG + Intronic
963261962 3:143201963-143201985 CCCACCAGCCTCTGCTGTGCTGG + Intergenic
967119561 3:186370901-186370923 GTCTCTAGTCTCAGCTGCTCAGG - Intergenic
967936932 3:194736275-194736297 TTCTCCAGCTTCTGCTGCAGTGG + Intergenic
968053922 3:195676309-195676331 GTCTCCTCCCTCTGTTGCCCAGG - Intergenic
968088331 3:195884770-195884792 GTCCCATGCCTCTGCTGCGCTGG + Intronic
968101969 3:195972844-195972866 GTCTCCTCCCTCTGTTGCCCAGG + Intergenic
968455668 4:698061-698083 GTCTCCAGGCTCTTCTGAGCAGG + Intergenic
968654056 4:1771104-1771126 GGCTCCAGGCTCTGCAGCTCTGG + Intergenic
968958708 4:3731903-3731925 GCCTCCAGCGTCTGCTTTGCTGG + Intergenic
969114847 4:4865089-4865111 TCCTCCAGCCTCTGCAGCTCGGG + Intergenic
969508878 4:7605839-7605861 GGCTGCAGCCTCTGCTGGGGTGG - Intronic
975773409 4:77756057-77756079 GACTGCAGCCTCTGCTTCCCAGG + Intronic
977568827 4:98609590-98609612 GTCTCCAGCCTCTCGTGTCCAGG + Intronic
984208948 4:176822114-176822136 TTCTCCTGCCTCTGCTTCCCGGG - Intergenic
985692849 5:1323214-1323236 GTGCCCGGCCTCTGCTGCCCGGG - Intronic
985692868 5:1323271-1323293 GCCTCCAGCCTCTGCTGCCCAGG - Intronic
985692887 5:1323329-1323351 GCCCCCAGCCTCTGTTGCCCAGG - Intronic
985692905 5:1323387-1323409 GCCTCCAGCCTCTGCTGCCCGGG - Intronic
986385075 5:7225096-7225118 GACTCCAGCACCTGCTGCCCTGG - Intergenic
987043963 5:14088973-14088995 GACTGCAGCCTCTGCCCCGCAGG - Intergenic
988995719 5:36713211-36713233 TTCTCCAGCCTCGGCAGTGCAGG + Intergenic
992546291 5:77817222-77817244 CTTTCCAGCCTCTGCAGTGCGGG + Intronic
993921214 5:93805470-93805492 TTCTCCAGACTCTTCTGTGCAGG - Intronic
996578137 5:124999202-124999224 GTCTCCTGGCTATGCTGCTCAGG + Intergenic
996852060 5:127964257-127964279 TTCTCCAGCCTCAGCTACTCTGG - Intergenic
997121415 5:131176858-131176880 GTCTCCAGCAGCTGCTGCAAAGG + Intronic
998037469 5:138929062-138929084 GTCTCGAGCCTCTGCTTCACTGG - Intronic
998078295 5:139254307-139254329 CACTGCAGCCTCTGCTGCCCAGG + Intronic
999439943 5:151593322-151593344 GGCTCCAGCCTGTCCAGCGCAGG + Intergenic
1000274263 5:159719216-159719238 GTCTCCTGCATCTGGTGTGCAGG - Intergenic
1001864728 5:175093482-175093504 GTCTCCAGCTGCTGCAGAGCAGG + Intergenic
1002684968 5:181002928-181002950 GTCTTCAGCCTCCTCTGTGCTGG + Intronic
1004246055 6:13977152-13977174 GTCTCAGGCCTCTGATGAGCTGG + Exonic
1004827502 6:19438956-19438978 GCCTCCAGACTTTGCTGTGCTGG - Intergenic
1005367724 6:25095996-25096018 GTCTCCAGCCTCTTCTGCCCTGG - Intergenic
1007739614 6:44002685-44002707 GTGTCCTGCCCCTGGTGCGCAGG - Exonic
1010422071 6:75687712-75687734 TTCTGCAGCCTCTGCTGGTCTGG - Intronic
1010486604 6:76421848-76421870 GACTTCAGCCTATGCTGCTCAGG - Intergenic
1011231726 6:85169365-85169387 GTCTGCAGCCTCTGCTCTTCTGG - Intergenic
1012250091 6:96970303-96970325 GGCTCAGGCCTCTGCTGCTCGGG + Intronic
1012582084 6:100881444-100881466 GCCTCCAGCCTCTAGTCCGCTGG + Intergenic
1013472255 6:110476224-110476246 GCCTCCAGCATCTGCTGCCGCGG + Intronic
1015273010 6:131356682-131356704 GTCTGTAGCCTCAGCTGCACAGG - Intergenic
1015804242 6:137092382-137092404 CTCTCCAGCCTGTGCAGTGCAGG + Intergenic
1017917814 6:158846199-158846221 GTCTCCAGCCTCTGCCCCACTGG - Intergenic
1019235625 6:170609924-170609946 GTTGACAGCCTCTGCTGGGCTGG - Intergenic
1019639678 7:2096798-2096820 GCCCCCAGCCTCTGCTGGGCGGG - Intronic
1022233247 7:28435482-28435504 GCCTCTAGCTTCTGCTGGGCCGG + Intronic
1022356767 7:29623151-29623173 GACTCCAACCTCTGCTTCCCGGG + Intergenic
1024238422 7:47415244-47415266 GTCTTCAGCCTCTGCTGAGAAGG + Intronic
1024669622 7:51582495-51582517 GTCTCCAGCCTTTGTTGTGGAGG + Intergenic
1025235498 7:57232146-57232168 TGCTCCAGCCTCTGCTGCTCTGG + Intergenic
1025239681 7:57260756-57260778 GACTGCAGCCTCTGCTTCCCAGG + Intergenic
1025772628 7:64527585-64527607 TTCTCCTGCCTCAGCTGCCCTGG - Intronic
1026043034 7:66884867-66884889 TTCTCCAGCCTGTGTTGCCCAGG + Intergenic
1027267089 7:76500390-76500412 CTCTCCAGCCTGTGCTCCTCAGG + Intronic
1027318902 7:77000258-77000280 CTCTCCAGCCTGTGCTCCTCAGG + Intergenic
1035448185 7:158957264-158957286 GATTCCAACCTCTGCGGCGCTGG + Intergenic
1035515457 8:228895-228917 GTTGACAGCCTCTGCTGGGCTGG - Intergenic
1035519437 8:265698-265720 GTCTCCAGCCTGCGCTGGGTGGG - Intergenic
1035663324 8:1363341-1363363 CTCTCCTGCCTCTGCCTCGCCGG + Intergenic
1035741232 8:1929988-1930010 CTCTCCAGCCCCTGCCGCGTTGG + Intronic
1038309364 8:26434172-26434194 GGCTCCAGGCACTGCTGTGCTGG + Intronic
1040408620 8:47133475-47133497 GTCTCCAGGCCCTGCTGAGCGGG + Intergenic
1041212804 8:55569655-55569677 TTCTCCAGCCTCTGGTGCCCAGG - Intergenic
1041278652 8:56189773-56189795 CTCTCCAGCCTCACCTGTGCAGG - Intronic
1045510448 8:102808697-102808719 GTCACCATCCTCTGCAACGCTGG + Intergenic
1046560081 8:115825237-115825259 GTCTCTAGCCTTTTCTGAGCAGG + Intergenic
1046672213 8:117068682-117068704 TTCTCCTGCCTCAGCTGCCCAGG + Intronic
1047843278 8:128777697-128777719 TTCTCCTGCCTCAGCTGCCCAGG + Intergenic
1048868185 8:138776193-138776215 GTGGCCTGCCTCTGCTGCCCAGG - Intronic
1049319335 8:141987620-141987642 GGCTCCAGCCTCTGCTGTTCCGG - Intergenic
1050151652 9:2623204-2623226 GTCCCCAGACTCTGCCGCGGGGG + Intronic
1052494660 9:29212240-29212262 GTCCCCCGCCCCTGCCGCGCGGG + Intergenic
1052996163 9:34552569-34552591 GCCTCCAGCCTCTGCTCCCGGGG - Intronic
1053016473 9:34665158-34665180 GGCTCCAGCTTCTGCTCCCCGGG + Exonic
1055569302 9:77600475-77600497 GTCTCCAGTCTTTCCTGCACAGG + Intronic
1060920477 9:127417257-127417279 TTCTCCAGCCTCTGCAAAGCAGG + Intergenic
1061626540 9:131843883-131843905 GACTCCAGCTTCTCCTGGGCGGG - Intergenic
1062258345 9:135642510-135642532 GTCTCCAGCATCTGATGCTGCGG + Intergenic
1062277088 9:135736298-135736320 CTCTCCAGCATCTGCCGCCCGGG + Intronic
1062384930 9:136305443-136305465 CTCTGCAGCCTCTGCTTCCCAGG + Intronic
1062522608 9:136964464-136964486 GTCTCCTTCCTCTGCCGAGCAGG - Intergenic
1203772860 EBV:58219-58241 GTCTCCGGCCTCTGCGGCCCCGG - Intergenic
1186382447 X:9075002-9075024 TTCTCCTGCCTCTGCTGCCATGG - Intronic
1187971019 X:24658602-24658624 CACTCCAGCCTCTGCTTCACTGG + Intronic
1189205899 X:39238580-39238602 GTCTCCAGCCTATCCAGTGCAGG + Intergenic
1196434749 X:115664801-115664823 ATCTCCTGCCACTGCTGCCCAGG + Intergenic
1199628313 X:149759960-149759982 GACTCCACCCTGTGCTGAGCAGG + Intergenic
1199991484 X:152989941-152989963 TTCTTCAGCCCCTGCTTCGCTGG + Exonic