ID: 1123034586

View in Genome Browser
Species Human (GRCh38)
Location 14:105466726-105466748
Sequence CTTGATGCCCAGTAGGGGTA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 86}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123034576_1123034586 15 Left 1123034576 14:105466688-105466710 CCCACCCCGGCGCTGCCAGGCAA 0: 1
1: 0
2: 1
3: 9
4: 144
Right 1123034586 14:105466726-105466748 CTTGATGCCCAGTAGGGGTAAGG 0: 1
1: 0
2: 0
3: 7
4: 86
1123034573_1123034586 23 Left 1123034573 14:105466680-105466702 CCCTCTCTCCCACCCCGGCGCTG 0: 1
1: 0
2: 3
3: 33
4: 399
Right 1123034586 14:105466726-105466748 CTTGATGCCCAGTAGGGGTAAGG 0: 1
1: 0
2: 0
3: 7
4: 86
1123034579_1123034586 10 Left 1123034579 14:105466693-105466715 CCCGGCGCTGCCAGGCAACATGA 0: 1
1: 0
2: 0
3: 6
4: 117
Right 1123034586 14:105466726-105466748 CTTGATGCCCAGTAGGGGTAAGG 0: 1
1: 0
2: 0
3: 7
4: 86
1123034574_1123034586 22 Left 1123034574 14:105466681-105466703 CCTCTCTCCCACCCCGGCGCTGC 0: 1
1: 0
2: 3
3: 48
4: 498
Right 1123034586 14:105466726-105466748 CTTGATGCCCAGTAGGGGTAAGG 0: 1
1: 0
2: 0
3: 7
4: 86
1123034577_1123034586 14 Left 1123034577 14:105466689-105466711 CCACCCCGGCGCTGCCAGGCAAC 0: 1
1: 0
2: 0
3: 18
4: 179
Right 1123034586 14:105466726-105466748 CTTGATGCCCAGTAGGGGTAAGG 0: 1
1: 0
2: 0
3: 7
4: 86
1123034581_1123034586 0 Left 1123034581 14:105466703-105466725 CCAGGCAACATGAAGAAGCGCCT 0: 1
1: 0
2: 0
3: 11
4: 181
Right 1123034586 14:105466726-105466748 CTTGATGCCCAGTAGGGGTAAGG 0: 1
1: 0
2: 0
3: 7
4: 86
1123034580_1123034586 9 Left 1123034580 14:105466694-105466716 CCGGCGCTGCCAGGCAACATGAA 0: 1
1: 0
2: 1
3: 7
4: 122
Right 1123034586 14:105466726-105466748 CTTGATGCCCAGTAGGGGTAAGG 0: 1
1: 0
2: 0
3: 7
4: 86
1123034578_1123034586 11 Left 1123034578 14:105466692-105466714 CCCCGGCGCTGCCAGGCAACATG 0: 1
1: 0
2: 0
3: 1
4: 88
Right 1123034586 14:105466726-105466748 CTTGATGCCCAGTAGGGGTAAGG 0: 1
1: 0
2: 0
3: 7
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123034586 Original CRISPR CTTGATGCCCAGTAGGGGTA AGG Exonic
900574616 1:3376905-3376927 CCTGATGCCCAATAGGGGGCTGG - Intronic
901064835 1:6489734-6489756 ATTGAGGCCCAGTAGGGGAAGGG - Intronic
903569637 1:24294818-24294840 GAAGATGCCCAGTAGGGGGAGGG + Intergenic
906147901 1:43570701-43570723 CTTGGTGCCCAGCAGGAGGAGGG + Intronic
909466051 1:75975105-75975127 CTTCATGCCCAGCATGGGGAGGG + Intergenic
915593742 1:156884779-156884801 CAAGCTGCCCAGCAGGGGTAGGG + Intergenic
915604738 1:156943397-156943419 TTTGATGCCCACAAGAGGTAGGG + Intronic
917247069 1:173015131-173015153 GTTTATGCCCAGCAGGGGCAGGG + Intergenic
919931529 1:202224408-202224430 CTAGATTCCCAGGTGGGGTAAGG - Intronic
920417650 1:205809618-205809640 ATTCCTGCCCAGTAGGGGGATGG + Intronic
920563639 1:206957081-206957103 CTTGAGGCCCAACAGGGTTAAGG - Intergenic
921714242 1:218401826-218401848 CTTGATGCCCAGTCGGGACGCGG - Intronic
923068237 1:230539499-230539521 CTTGCTGGCCAGTTGGTGTAAGG + Intergenic
1063128211 10:3154044-3154066 CTGGAGGCCCAGTCGGGGTGTGG - Intronic
1070124410 10:73609056-73609078 CCTGATGCCCACTAGGTCTAAGG - Intronic
1072158184 10:92742900-92742922 CTGGATGTCCAGTAGGGGATGGG + Intergenic
1072475045 10:95751825-95751847 CTTGACACCCAGTAGGTGGATGG + Intronic
1073516549 10:104080934-104080956 CTTGATGCTCAGCAGGGGGCAGG - Intronic
1074773178 10:116746328-116746350 CATGATGCACAGCATGGGTAGGG + Intergenic
1075022050 10:118959323-118959345 TTTGATGCCAAGGAGGGGTGGGG - Intergenic
1075124777 10:119690976-119690998 CTTCAGGCCTAATAGGGGTAAGG + Intergenic
1079094446 11:17501670-17501692 GTTGAAGACCAGTAGGGGTGGGG - Intronic
1081957715 11:47108019-47108041 GGGGATGCCCAGGAGGGGTATGG - Intronic
1083184423 11:61008890-61008912 CTTGGCGCCCAGTAGGCCTATGG - Intronic
1087667270 11:101065157-101065179 CTTGCTGCCCTGTAAGGATAGGG + Intronic
1089294469 11:117459447-117459469 CTGGACTCCCAGTTGGGGTAAGG + Intronic
1090266330 11:125355466-125355488 CTTTATGCCCTGAAGAGGTAGGG + Intronic
1090730821 11:129572154-129572176 CTGCATGTCCAGCAGGGGTAGGG - Intergenic
1095940449 12:47723638-47723660 CTTGATGGCCAGTATGGATAGGG - Intronic
1098569064 12:71968577-71968599 CCTGCTGCCCAGTAAGGGTCCGG + Intronic
1102131738 12:110536293-110536315 CCTGATCTCCAGGAGGGGTAGGG - Exonic
1105702570 13:22944224-22944246 CTGGAAGCCCAGTAGGGAAAGGG - Intergenic
1108434591 13:50389470-50389492 CTTGAAGCCCAGGAAGGGTGTGG - Intronic
1109473062 13:62836074-62836096 CTTGATGACTAGTAGGAATAAGG - Intergenic
1117918690 14:60705278-60705300 CTTGATACCCAGTAGGGAAGTGG + Intergenic
1122666333 14:103333316-103333338 CGTGATGCCCACTAGGAGAAAGG + Intergenic
1123034586 14:105466726-105466748 CTTGATGCCCAGTAGGGGTAAGG + Exonic
1123677936 15:22730684-22730706 CTTGATGTCCAGCAGGGATTGGG + Intergenic
1124330133 15:28804951-28804973 CTTGATGTCCAGCAGGGATTGGG + Intergenic
1125341275 15:38677923-38677945 CCTGCTACCCAGTGGGGGTAGGG - Intergenic
1127980403 15:64030626-64030648 GTTGAGGGCGAGTAGGGGTAGGG - Intronic
1129771325 15:78205110-78205132 CTTGAAGCCCAGCAGGAGAAGGG - Intronic
1132948993 16:2549845-2549867 CTAGATGCCATGTAGGGGAATGG + Intronic
1132965594 16:2652282-2652304 CTAGATGCCATGTAGGGGAATGG - Intergenic
1141642817 16:85351185-85351207 CTGGATGCCCAGGAGGGAGAGGG + Intergenic
1144945411 17:18967174-18967196 CTAGAGGCCCAGTAGGTGTGCGG - Intronic
1145278937 17:21454660-21454682 CAAGATACCCAGTAGGGGAAGGG - Intergenic
1145398930 17:22515838-22515860 CGAGATGCCCAGTAGGGGAAAGG + Intergenic
1148713851 17:49701480-49701502 CTTGATGCCAAGTTTGGGAAAGG - Exonic
1157482175 18:48062281-48062303 CTTGATCCCCAGAAGGGGAGAGG + Intronic
1157802294 18:50630523-50630545 CTGGATGCCCAGAATGGCTACGG - Intronic
1158848444 18:61469495-61469517 CTGGCTGCCCAGTTAGGGTAAGG + Intronic
925883196 2:8369935-8369957 CTTGAAGGCCAGTAGGATTAAGG - Intergenic
944514078 2:200493784-200493806 CTTTATTCCCAGTAGTCGTAGGG + Intronic
947455530 2:230250535-230250557 CCTGATGCCCAGTATGAGAAAGG + Intronic
948825362 2:240571196-240571218 CTTGCTGCCCAGCAGGGCCAGGG + Intronic
1170704435 20:18732658-18732680 CTTGTTCCCCAGTAGGGTTAGGG + Intronic
1171198533 20:23222940-23222962 CTTGTGGCCAAGTAGGGGCAGGG - Intergenic
1173737571 20:45372886-45372908 CTTGGTGCCCAGTAATGGTGGGG + Exonic
1175123059 20:56731284-56731306 CTTCAGGCCCAGGAGGGGTCAGG - Intergenic
1180522245 22:16220088-16220110 CTTGATTCCCAGCATGGGTCTGG + Intergenic
1181576487 22:23798559-23798581 CTTGATCGCTGGTAGGGGTAGGG - Intronic
950400198 3:12763828-12763850 AATGATGCCCTGTAGGTGTATGG + Intronic
951847047 3:27095920-27095942 CTTGATATCCAGTAGGGTTGGGG + Intergenic
952488596 3:33842120-33842142 CTTGATGTCCAGCAGGGATTGGG + Intronic
954384594 3:50237507-50237529 CTTGCAGCCCAGAAGGGGTGTGG - Intronic
956135061 3:66090122-66090144 CTGGATGTTCAGTTGGGGTAGGG + Intergenic
963739176 3:149057822-149057844 CATGTTGTCCAGTAGGGGAATGG - Intronic
963878613 3:150503587-150503609 CCTGAGGGCCACTAGGGGTAGGG - Intergenic
966765112 3:183454315-183454337 CTTGTTGCCCAGAAGGAGTCAGG + Intergenic
968746133 4:2361557-2361579 CTTGAGGCCCAGGAGGGCTGGGG + Intronic
969156857 4:5218899-5218921 CCTGAGGCCCAGTAGGGGCCTGG - Intronic
976148180 4:82064702-82064724 CTGGTTGCCCAGTTGGAGTAGGG - Intergenic
976155939 4:82144797-82144819 CAGGAAGCCCAGTAGGGGAATGG - Intergenic
985859070 5:2456097-2456119 CTTGATGCCCAGGAGCGGCCTGG - Intergenic
986142366 5:5043030-5043052 CATGATCCCAAGTAGTGGTAAGG - Intergenic
986917015 5:12632870-12632892 CTTGTTGCCCAGGAGTGGAATGG - Intergenic
1001784603 5:174401285-174401307 CTTCATACATAGTAGGGGTAGGG + Intergenic
1003852699 6:10241449-10241471 TTTGATGCCCAGCTGGGGTTGGG - Intergenic
1014579864 6:123123728-123123750 CTTGATGCCCAGTTGGCTTTGGG - Intergenic
1015757771 6:136625368-136625390 CTTAATGCCCAGGAGGGGATAGG + Intronic
1016329642 6:142944135-142944157 CTTGGTTCCCAGTGGGGGAAAGG - Intronic
1018030199 6:159835686-159835708 CTGGCTGCCCAGATGGGGTAGGG + Intergenic
1023392999 7:39728529-39728551 GTGGATGCCCAATAGGGGAAAGG - Intergenic
1032835759 7:135671878-135671900 CTTGAGGCCCAGGATGGGAAGGG - Intronic
1042117586 8:65448994-65449016 GTTGTTGTCCAGTAGGGGTATGG - Intergenic
1050022000 9:1293971-1293993 GTTGATGGCCAGTAGGAGTAGGG + Intergenic
1059197533 9:112384436-112384458 ATTGATTCCCAGTAGGAGAAAGG - Intronic
1060511469 9:124237532-124237554 CTTGATGCTCGGTGGGGGAAGGG + Intergenic
1060545695 9:124457857-124457879 CTTGATGCCATGCAGGGGTGGGG + Intronic
1062221731 9:135419682-135419704 CTTGATGCCCAGTAGGGAGCCGG - Intergenic
1188924909 X:36027664-36027686 GTTTATGCCCAGTAGTGGGATGG + Intergenic
1189269853 X:39743584-39743606 CTTCTTTCCCAGTAGGGGCAAGG + Intergenic
1193822692 X:86185387-86185409 CTTTATTCCATGTAGGGGTAGGG + Intronic