ID: 1123035813

View in Genome Browser
Species Human (GRCh38)
Location 14:105471501-105471523
Sequence AGGGCGCCTGGGTGGGCTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123035813_1123035824 1 Left 1123035813 14:105471501-105471523 CCCCCAGCCCACCCAGGCGCCCT No data
Right 1123035824 14:105471525-105471547 TCATGTGGAAATCTCAGCCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123035813 Original CRISPR AGGGCGCCTGGGTGGGCTGG GGG (reversed) Intergenic
No off target data available for this crispr