ID: 1123035824

View in Genome Browser
Species Human (GRCh38)
Location 14:105471525-105471547
Sequence TCATGTGGAAATCTCAGCCA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123035816_1123035824 -2 Left 1123035816 14:105471504-105471526 CCAGCCCACCCAGGCGCCCTGTC No data
Right 1123035824 14:105471525-105471547 TCATGTGGAAATCTCAGCCACGG No data
1123035815_1123035824 -1 Left 1123035815 14:105471503-105471525 CCCAGCCCACCCAGGCGCCCTGT No data
Right 1123035824 14:105471525-105471547 TCATGTGGAAATCTCAGCCACGG No data
1123035811_1123035824 9 Left 1123035811 14:105471493-105471515 CCTTTGCTCCCCCAGCCCACCCA No data
Right 1123035824 14:105471525-105471547 TCATGTGGAAATCTCAGCCACGG No data
1123035810_1123035824 20 Left 1123035810 14:105471482-105471504 CCAGAGCTGTGCCTTTGCTCCCC No data
Right 1123035824 14:105471525-105471547 TCATGTGGAAATCTCAGCCACGG No data
1123035820_1123035824 -10 Left 1123035820 14:105471512-105471534 CCCAGGCGCCCTGTCATGTGGAA No data
Right 1123035824 14:105471525-105471547 TCATGTGGAAATCTCAGCCACGG No data
1123035817_1123035824 -6 Left 1123035817 14:105471508-105471530 CCCACCCAGGCGCCCTGTCATGT No data
Right 1123035824 14:105471525-105471547 TCATGTGGAAATCTCAGCCACGG No data
1123035818_1123035824 -7 Left 1123035818 14:105471509-105471531 CCACCCAGGCGCCCTGTCATGTG No data
Right 1123035824 14:105471525-105471547 TCATGTGGAAATCTCAGCCACGG No data
1123035808_1123035824 22 Left 1123035808 14:105471480-105471502 CCCCAGAGCTGTGCCTTTGCTCC No data
Right 1123035824 14:105471525-105471547 TCATGTGGAAATCTCAGCCACGG No data
1123035814_1123035824 0 Left 1123035814 14:105471502-105471524 CCCCAGCCCACCCAGGCGCCCTG No data
Right 1123035824 14:105471525-105471547 TCATGTGGAAATCTCAGCCACGG No data
1123035813_1123035824 1 Left 1123035813 14:105471501-105471523 CCCCCAGCCCACCCAGGCGCCCT No data
Right 1123035824 14:105471525-105471547 TCATGTGGAAATCTCAGCCACGG No data
1123035809_1123035824 21 Left 1123035809 14:105471481-105471503 CCCAGAGCTGTGCCTTTGCTCCC No data
Right 1123035824 14:105471525-105471547 TCATGTGGAAATCTCAGCCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123035824 Original CRISPR TCATGTGGAAATCTCAGCCA CGG Intergenic
No off target data available for this crispr