ID: 1123036027

View in Genome Browser
Species Human (GRCh38)
Location 14:105472302-105472324
Sequence CAGGCTGCTGTCTCATCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123036027_1123036038 20 Left 1123036027 14:105472302-105472324 CCTGCTGATGAGACAGCAGCCTG No data
Right 1123036038 14:105472345-105472367 ACAGGGGCCGCGGCTCCCCAGGG No data
1123036027_1123036040 26 Left 1123036027 14:105472302-105472324 CCTGCTGATGAGACAGCAGCCTG No data
Right 1123036040 14:105472351-105472373 GCCGCGGCTCCCCAGGGCCAGGG No data
1123036027_1123036030 3 Left 1123036027 14:105472302-105472324 CCTGCTGATGAGACAGCAGCCTG No data
Right 1123036030 14:105472328-105472350 TCTGCACCAGCAACCCCACAGGG No data
1123036027_1123036039 25 Left 1123036027 14:105472302-105472324 CCTGCTGATGAGACAGCAGCCTG No data
Right 1123036039 14:105472350-105472372 GGCCGCGGCTCCCCAGGGCCAGG No data
1123036027_1123036033 10 Left 1123036027 14:105472302-105472324 CCTGCTGATGAGACAGCAGCCTG No data
Right 1123036033 14:105472335-105472357 CAGCAACCCCACAGGGGCCGCGG No data
1123036027_1123036037 19 Left 1123036027 14:105472302-105472324 CCTGCTGATGAGACAGCAGCCTG No data
Right 1123036037 14:105472344-105472366 CACAGGGGCCGCGGCTCCCCAGG No data
1123036027_1123036042 27 Left 1123036027 14:105472302-105472324 CCTGCTGATGAGACAGCAGCCTG No data
Right 1123036042 14:105472352-105472374 CCGCGGCTCCCCAGGGCCAGGGG No data
1123036027_1123036031 4 Left 1123036027 14:105472302-105472324 CCTGCTGATGAGACAGCAGCCTG No data
Right 1123036031 14:105472329-105472351 CTGCACCAGCAACCCCACAGGGG No data
1123036027_1123036029 2 Left 1123036027 14:105472302-105472324 CCTGCTGATGAGACAGCAGCCTG No data
Right 1123036029 14:105472327-105472349 TTCTGCACCAGCAACCCCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123036027 Original CRISPR CAGGCTGCTGTCTCATCAGC AGG (reversed) Intergenic
No off target data available for this crispr