ID: 1123036134

View in Genome Browser
Species Human (GRCh38)
Location 14:105472735-105472757
Sequence GATCCTGACCCCTGCCTGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123036131_1123036134 -4 Left 1123036131 14:105472716-105472738 CCACTGCTCTGCACCCATTGATC No data
Right 1123036134 14:105472735-105472757 GATCCTGACCCCTGCCTGCCAGG No data
1123036126_1123036134 26 Left 1123036126 14:105472686-105472708 CCACCGCAGCCTCAGAGGTGGAG No data
Right 1123036134 14:105472735-105472757 GATCCTGACCCCTGCCTGCCAGG No data
1123036130_1123036134 2 Left 1123036130 14:105472710-105472732 CCAAGGCCACTGCTCTGCACCCA No data
Right 1123036134 14:105472735-105472757 GATCCTGACCCCTGCCTGCCAGG No data
1123036125_1123036134 27 Left 1123036125 14:105472685-105472707 CCCACCGCAGCCTCAGAGGTGGA No data
Right 1123036134 14:105472735-105472757 GATCCTGACCCCTGCCTGCCAGG No data
1123036129_1123036134 17 Left 1123036129 14:105472695-105472717 CCTCAGAGGTGGAGACCAAGGCC No data
Right 1123036134 14:105472735-105472757 GATCCTGACCCCTGCCTGCCAGG No data
1123036127_1123036134 23 Left 1123036127 14:105472689-105472711 CCGCAGCCTCAGAGGTGGAGACC No data
Right 1123036134 14:105472735-105472757 GATCCTGACCCCTGCCTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123036134 Original CRISPR GATCCTGACCCCTGCCTGCC AGG Intergenic