ID: 1123036916

View in Genome Browser
Species Human (GRCh38)
Location 14:105475286-105475308
Sequence CCGCGCGCTCCCGTGGGCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 142}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123036904_1123036916 22 Left 1123036904 14:105475241-105475263 CCGGGCGGGGCGGGGCAGGGCGT 0: 1
1: 2
2: 25
3: 102
4: 549
Right 1123036916 14:105475286-105475308 CCGCGCGCTCCCGTGGGCCTGGG 0: 1
1: 0
2: 0
3: 8
4: 142
1123036908_1123036916 -10 Left 1123036908 14:105475273-105475295 CCCCGGGTGCGTCCCGCGCGCTC 0: 1
1: 0
2: 1
3: 4
4: 55
Right 1123036916 14:105475286-105475308 CCGCGCGCTCCCGTGGGCCTGGG 0: 1
1: 0
2: 0
3: 8
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123036916 Original CRISPR CCGCGCGCTCCCGTGGGCCT GGG Intronic
900138179 1:1127636-1127658 CCGGGTGCTGCCCTGGGCCTAGG + Intergenic
902873352 1:19327010-19327032 CCACGGTCTCCCGTGGACCTGGG + Intronic
903462816 1:23531068-23531090 CCCCGCGCTCCCCAAGGCCTCGG + Exonic
903777153 1:25800388-25800410 CCGCGCGGCCGCCTGGGCCTCGG - Exonic
903795116 1:25922915-25922937 CCGCGTGCGCCCGGGGGTCTGGG - Intergenic
907278001 1:53327606-53327628 CCCCCCGCCCCCGCGGGCCTCGG - Intronic
908555591 1:65254320-65254342 CCGCGCGCACCCGCACGCCTCGG + Intronic
908898101 1:68923847-68923869 CAGCGAGATTCCGTGGGCCTAGG - Intergenic
909114209 1:71514070-71514092 CAGCGCGATTCCGTGGGCGTAGG - Intronic
911647466 1:100352231-100352253 CCGCCCGCTCCCCTGGGCCGAGG + Intronic
919446148 1:197708074-197708096 CAGCGCGATTCCGTGGGCGTAGG - Intronic
919633163 1:199978620-199978642 CAGTGTTCTCCCGTGGGCCTCGG - Intergenic
920409720 1:205749807-205749829 CCGCGCGCACCCTTGAGCGTGGG - Intronic
923055886 1:230425902-230425924 CCGCGCGCCCCCGCCGCCCTCGG + Intergenic
923786810 1:237075622-237075644 CAGCGCGATTCCGTGGGCGTAGG - Intronic
924289532 1:242524058-242524080 CGACTCGCTCCCGGGGGCCTCGG - Intronic
1062760133 10:11632-11654 CAGCGCGCTCCCGGGGGCAGAGG + Intergenic
1067474378 10:46556461-46556483 CCGCGCGCTCCCGTTGGGGCGGG - Intergenic
1068940677 10:62677984-62678006 CCGCGAGATTCCGTGGGCGTAGG + Intergenic
1069831466 10:71284715-71284737 CCTCGCGCACCCGCAGGCCTGGG - Exonic
1070795130 10:79211819-79211841 CCTCTCCCTCCCGTGGGCTTAGG + Intronic
1070799053 10:79234309-79234331 CCACGCCCTTCCCTGGGCCTCGG + Intronic
1077492821 11:2870006-2870028 CCGCGCGCTCCCTCCCGCCTGGG + Intergenic
1081632737 11:44700818-44700840 GCGCTCCCTCCCCTGGGCCTGGG - Intergenic
1088334162 11:108685177-108685199 CAGCGCGATTCCGTGGGCGTAGG + Intronic
1091850489 12:3693154-3693176 GCGGGGGCTGCCGTGGGCCTGGG + Intronic
1092256198 12:6927970-6927992 CCGCGCGATCCCGGGCCCCTCGG - Intronic
1095250941 12:39978669-39978691 CCGCGAGATTCCGTGGGCGTAGG - Intronic
1096232567 12:49904410-49904432 CCCTGCGCTCCTGTGGGCCTGGG + Intergenic
1096459384 12:51814041-51814063 GCGCGCGCCCCCGGGGGCCTGGG - Intergenic
1101640114 12:106581568-106581590 CCGCGCGCTGCCAGGGGCCCGGG + Intronic
1104942065 12:132399822-132399844 CCGCGGGCTCCCGGACGCCTGGG + Intergenic
1104975858 12:132551720-132551742 CCGCCCCCTCCCCTGGCCCTTGG + Intronic
1105956441 13:25287444-25287466 CCGCGGCCTCCCGGGGGACTCGG + Exonic
1112278758 13:98044601-98044623 CCGCCCGCTCCCTGGGGCCAAGG + Intergenic
1113256926 13:108516121-108516143 CAGCGCGATTCCGTGGGCGTAGG + Intergenic
1115977944 14:39017539-39017561 CAGCGCGACTCCGTGGGCCTAGG - Intergenic
1118752355 14:68816459-68816481 CCGCGCGCTGCCGAGCGCGTCGG - Intergenic
1120953484 14:90062161-90062183 ACGCCCGGTGCCGTGGGCCTGGG + Exonic
1122226906 14:100285607-100285629 CTCCGCGCCCCCGTGGCCCTGGG - Intergenic
1123036916 14:105475286-105475308 CCGCGCGCTCCCGTGGGCCTGGG + Intronic
1126707814 15:51422866-51422888 CAGCGCGATTCCGTGGGCGTAGG + Intergenic
1128720015 15:69941399-69941421 CGGCCCGCACCCGAGGGCCTCGG + Intergenic
1130391146 15:83456454-83456476 CAGCGCGATTCCGTGGGCGTAGG + Intronic
1132293311 15:100718206-100718228 CAGCGCGCTGCCTTGGCCCTGGG - Intergenic
1132512016 16:347799-347821 CCGAGCGCCTCTGTGGGCCTGGG - Intronic
1132572292 16:649415-649437 CCGCGCGCTACCTCGGGCCATGG - Exonic
1132580824 16:683960-683982 TCGCGCGCACGCGTGGGGCTGGG - Intronic
1132862548 16:2078748-2078770 CCTAGTGCTCCCGTGGGCTTCGG + Intronic
1133229607 16:4360335-4360357 CCGCGTCCTCCCTTGGGCCCTGG + Exonic
1137528543 16:49261030-49261052 CCCCGAGATCCCGTGGGACTTGG + Intergenic
1139779537 16:69339424-69339446 CCGCTCGCGCCACTGGGCCTCGG + Exonic
1142204842 16:88778006-88778028 CCGGGAGCTCCTGCGGGCCTGGG + Intronic
1142218160 16:88839969-88839991 TCACGCGCTCCAGTGGCCCTCGG + Intronic
1143116531 17:4584587-4584609 CCGCGCGCTCTGCTGGGCCATGG + Exonic
1144756156 17:17681763-17681785 CCGCGCTCACTCGGGGGCCTTGG - Exonic
1146417934 17:32654497-32654519 CCTCGGGCTCCAGAGGGCCTGGG - Exonic
1147684052 17:42276405-42276427 GCGCGCGCCCCCGCGGGCCCCGG - Exonic
1147742307 17:42676244-42676266 CCGAGAGCTCCCGGGGGCTTTGG + Intronic
1148899541 17:50865946-50865968 CCCCGAGCTCCCGAGGGCCCAGG + Intronic
1152049211 17:77959162-77959184 CCGCGCACTCCCGAGGCCCTCGG + Intergenic
1152552280 17:81035612-81035634 CCGCGCGCTCGCCTTGGCGTCGG + Intronic
1152953040 18:11986-12008 CAGCGCGCTCCCGGGGGCAGAGG + Intergenic
1157338188 18:46756570-46756592 CCGCGCGCCCCCCGGGGCCCCGG - Exonic
1159241702 18:65750816-65750838 CCGCGCGCTCCCGCTGGCTCCGG + Intronic
1160174065 18:76579035-76579057 CGGGGCGCTTCCCTGGGCCTCGG - Intergenic
1160842774 19:1154015-1154037 CCACCCGCCCCCGTGGGCCCTGG - Intronic
1161939735 19:7395014-7395036 CGGGGCGCTCCCGGGGACCTGGG - Intronic
1162741913 19:12778335-12778357 CCGTACGCACCCGGGGGCCTCGG + Intronic
1162799398 19:13102678-13102700 CCGCGCCTCCTCGTGGGCCTCGG + Exonic
1162951315 19:14073456-14073478 CCCCGCGCTCCCGCGCGCCCTGG + Exonic
1163631433 19:18419740-18419762 CCGCGCTCTTCCGTGGGCTCCGG + Intronic
1163748176 19:19060262-19060284 CAGCGTCCTCCCCTGGGCCTGGG + Intronic
1165080106 19:33302068-33302090 CCGGGCGCGCCCGCGGGCCCCGG - Exonic
1165851452 19:38852218-38852240 CCGCGCGCGGCCGGGGGCCAGGG - Intronic
1167796725 19:51714132-51714154 TCGCGTGCTCCCTGGGGCCTGGG + Intronic
1168293985 19:55369960-55369982 CCGCGGGCTCCCTGGGGCCTGGG + Intronic
924987713 2:287550-287572 CCGAGCGCGCCCGAGGGCCGGGG - Intronic
924988350 2:289858-289880 GCCCGCGCTCACGTGCGCCTGGG - Intergenic
927931735 2:27049987-27050009 CCCCGACCTCACGTGGGCCTCGG + Intronic
934296808 2:91748991-91749013 GGGCGCGCTGCCATGGGCCTTGG - Intergenic
938496729 2:131801759-131801781 CGGCGCGCTCCCGGGGGCAGAGG - Intergenic
942346254 2:175005440-175005462 CCGCGCGCGCCCGTTGCCATGGG - Intergenic
942565792 2:177264254-177264276 GAGCCCGCTCGCGTGGGCCTTGG - Intronic
942879285 2:180839309-180839331 CAGCGCGATTCCGTGGGCGTAGG + Intergenic
946227027 2:218269658-218269680 CCGCGCGCCCCCGCGGACCCCGG - Intronic
947810886 2:233003301-233003323 CCCCGCGCTGCTGTGGGTCTGGG - Intronic
1169827943 20:9790406-9790428 CCTCGCATTCCCCTGGGCCTTGG - Intronic
1175899556 20:62354636-62354658 CCGCCCCCTCCTGTGTGCCTCGG - Intronic
1175921865 20:62453858-62453880 CAGGGACCTCCCGTGGGCCTGGG + Intergenic
1176101280 20:63365668-63365690 CCTCGCCCTCCCGTGGACCCGGG + Intronic
1176141616 20:63547487-63547509 TCGCGGGCTCCCATGGCCCTCGG - Exonic
1177810351 21:25918727-25918749 CAGCGCGATTCCGTGGGCGTAGG - Intronic
1180101595 21:45590329-45590351 CCGCGCGCTCTGCTGGGTCTGGG - Intergenic
1180837547 22:18937835-18937857 GTGGGCTCTCCCGTGGGCCTGGG - Intergenic
1180908549 22:19432242-19432264 CTGCGCCCTCGCGCGGGCCTCGG - Exonic
1181063516 22:20293671-20293693 GTGGGCTCTCCCGTGGGCCTGGG + Intergenic
1181407887 22:22697797-22697819 CCCCACCCTCACGTGGGCCTGGG - Intergenic
1203287640 22_KI270734v1_random:163134-163156 GTGGGCTCTCCCGTGGGCCTGGG - Intergenic
954912805 3:54122737-54122759 CCGCGCGTCCCGGGGGGCCTCGG + Exonic
959085922 3:101850117-101850139 CGGCTCCCTCCCGCGGGCCTCGG + Intronic
961441851 3:126958085-126958107 CCTCCCACTCCAGTGGGCCTCGG + Intronic
962598264 3:136969342-136969364 CAGCGCGATTCCGTGGGCGTAGG + Intronic
962882468 3:139591315-139591337 CAGCGCGATTCCGTGGGCGTAGG - Intronic
963061819 3:141232113-141232135 CCGCGCTCGCCCCTGAGCCTAGG + Intronic
966449067 3:180037095-180037117 GCGCGCGTTCCCAGGGGCCTGGG + Intergenic
968477878 4:820891-820913 CTCCGCGCCCCCGTGGGGCTGGG - Intronic
970195635 4:13547773-13547795 CTGCGCGCCCCCGAGGGCCGGGG - Intergenic
970823858 4:20251709-20251731 GCGCGCGTTCCCGTGCGCCCTGG - Intergenic
971196071 4:24472305-24472327 CCGCGCGCTCACTTGGTACTTGG - Intergenic
977161762 4:93643958-93643980 CCGCGAGATTCCGTGGGCGTAGG + Intronic
981093327 4:140755808-140755830 CCGCCCGGTCCCCTGGGGCTGGG - Intronic
984667840 4:182448263-182448285 CCGCGCTCGCCCCTGGGCCTCGG - Intronic
984698225 4:182800129-182800151 GCGCGCGCTCGCCCGGGCCTGGG + Exonic
992102381 5:73419806-73419828 GCGCGCGGTTCCGAGGGCCTGGG - Intergenic
992269849 5:75053257-75053279 CCGCGCGCTCTGGTGGCCCCGGG + Intergenic
992468509 5:77030675-77030697 CCGCGCGCTCCAGTGGTCTCTGG + Exonic
996717712 5:126601104-126601126 CTGCGCGCTCCCCGGGGCCCAGG - Intronic
999248293 5:150167038-150167060 CCCCGCGCCCCCGACGGCCTGGG + Exonic
999584599 5:153076633-153076655 CAGCGCGATTCCGTGGGCGTAGG + Intergenic
1002826324 6:777563-777585 CCTCCCGCCCCCGTGGGACTTGG + Intergenic
1005300327 6:24464385-24464407 CCAAGCTCTCCCGTGGACCTGGG - Intronic
1014778167 6:125533977-125533999 CCGCACTCTCCCGCGGGCCCCGG + Intergenic
1018419682 6:163630905-163630927 CCCCGCGCTCCTGGGGGCCTGGG + Intergenic
1018583286 6:165326952-165326974 CCGGGAGCTTCCGTGGCCCTCGG - Intergenic
1019406371 7:886224-886246 CCTTGCGCTGCCCTGGGCCTCGG + Intronic
1025004705 7:55344799-55344821 CCGCGCTCTCCCCAGCGCCTGGG + Intergenic
1029044557 7:97614016-97614038 CAGCGCGATTCCGTGGGCGTAGG - Intergenic
1029437310 7:100570449-100570471 CCCCGGGCTTCCGGGGGCCTCGG + Intergenic
1030227526 7:107169366-107169388 CCGCGAGCTCACCTGGGCTTCGG + Intronic
1032094517 7:128931304-128931326 CCGCTCCCTCCCCTGGGCCTGGG - Intergenic
1033229024 7:139582436-139582458 GCCAGCGCTCCTGTGGGCCTGGG - Intronic
1034516253 7:151582568-151582590 CCACGTGCTTCCGTGAGCCTTGG - Intronic
1034964215 7:155381751-155381773 CCGCCCGCTCCCGAGGCTCTAGG + Intergenic
1035129625 7:156640323-156640345 CCGCCCGCCCACCTGGGCCTGGG - Exonic
1035212073 7:157336404-157336426 CCACGCGCTCCCGTTCGCCGGGG + Intronic
1036786703 8:11692731-11692753 CCGCGCCCTCGCGTGGGTCCCGG - Intronic
1036964002 8:13276368-13276390 GCGCGCCATCACGTGGGCCTTGG + Intronic
1039326417 8:36490153-36490175 CAGCGAGATTCCGTGGGCCTAGG + Intergenic
1039463130 8:37762615-37762637 CCACGGGCTGCCGGGGGCCTGGG + Exonic
1048214392 8:132481289-132481311 CCTGGAGCTCCCGTGGGCGTTGG + Intergenic
1049725026 8:144141877-144141899 CCCAGCCCTCCCGTGGGCCCTGG + Intergenic
1056572021 9:87824774-87824796 CCGCGCGCTTCGGCGCGCCTTGG + Intergenic
1057190500 9:93084437-93084459 CCAGGCCCTCCAGTGGGCCTGGG - Intronic
1057331411 9:94119185-94119207 CAGCGCGATTCCGTGGGCGTAGG + Intergenic
1057513187 9:95697939-95697961 CAGCGCGATTCCGTGGGCGTAGG - Intergenic
1057631099 9:96719811-96719833 CCGCGCTCTCCCCTGGGGCGCGG - Intergenic
1186611087 X:11139114-11139136 CCGCGGGCTTCCCTGGGCCCGGG + Exonic
1193603946 X:83542754-83542776 CAGCGCGATTCCGTGGGCGTAGG - Intergenic
1199760116 X:150898700-150898722 CCGCGCGCGCGCGCGGGCTTTGG - Exonic
1200150188 X:153947468-153947490 CAGGGGGCTCCCGTGAGCCTCGG + Intergenic