ID: 1123037778

View in Genome Browser
Species Human (GRCh38)
Location 14:105478431-105478453
Sequence CATGCTGCGCAGAGGGGCGC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 3, 3: 6, 4: 134}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123037778_1123037788 23 Left 1123037778 14:105478431-105478453 CCCGCGCCCCTCTGCGCAGCATG 0: 1
1: 0
2: 3
3: 6
4: 134
Right 1123037788 14:105478477-105478499 CCGTGCTACGCCACCCTGTTCGG 0: 1
1: 0
2: 0
3: 2
4: 25

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123037778 Original CRISPR CATGCTGCGCAGAGGGGCGC GGG (reversed) Exonic
900186121 1:1334041-1334063 CATGCTGCCCACGGAGGCGCTGG + Exonic
900807617 1:4778096-4778118 CATGCTACGCAGTGGCGCACTGG - Intronic
902697317 1:18149156-18149178 CAGGCTGGACAGAGGGGCTCAGG - Intronic
903044235 1:20553668-20553690 CAGGCGGCGCAGTGGGGCGCGGG - Exonic
904494584 1:30879480-30879502 CTTTCTGGGCAGAGGGGAGCTGG - Intronic
906562611 1:46770259-46770281 CATCCTGGGCAGAGGGGCTGGGG + Intronic
907426721 1:54384381-54384403 CAGACTGCACAGAGGGGCCCTGG + Intronic
910278423 1:85472229-85472251 AATGCTGCTCAGAGAGGCGAAGG + Intronic
911449474 1:98045666-98045688 GAAGCTGGGCAGAGGGTCGCTGG - Intergenic
912826775 1:112911652-112911674 CATGCTGGGCACAGTGGCTCAGG - Intergenic
915492812 1:156260805-156260827 CAGGCAGAGCAGAGGGGCTCAGG + Intronic
915517161 1:156420318-156420340 TACACTGCGCAGAGGGGCCCGGG - Intronic
919921515 1:202169068-202169090 CATTCTGCCCACAGGGTCGCAGG - Intergenic
921128001 1:212195335-212195357 CATGCAGGGCAGTGGGGCCCTGG - Intergenic
922317857 1:224458353-224458375 TATGCTTAGCAGAGGGGCTCTGG + Intronic
922926185 1:229348588-229348610 GATACTTCGCAGAAGGGCGCAGG - Intergenic
923079973 1:230643913-230643935 CATGCTGGGGAGAGGTGCCCTGG + Intronic
1070368091 10:75755769-75755791 CAGGCTGTGCAGTGGGGAGCAGG + Intronic
1070806527 10:79274160-79274182 CCTGCAGCACAGAGGGGCTCAGG + Intronic
1075514623 10:123099122-123099144 CATGCTGTGAAGAGAGGCACAGG - Intergenic
1076739932 10:132478089-132478111 CAGGCTGAGGAGAGGGGCCCTGG + Intergenic
1077158338 11:1101473-1101495 CATGCTGCGCAGAGTGCCATGGG - Intergenic
1077214323 11:1389141-1389163 CATGCTGCGCTGGAGGGGGCGGG - Intergenic
1077475435 11:2788140-2788162 CATGGGGTGGAGAGGGGCGCTGG - Intronic
1080749877 11:35141689-35141711 GATGCTGCGCAAAGGGGCCGTGG - Intronic
1084658161 11:70531415-70531437 CATGCTTGGCAGAGGTGAGCTGG + Intronic
1089603731 11:119629687-119629709 CATGCTGTGCAGGGGGGCATGGG + Intronic
1091675857 12:2488768-2488790 CCTGCTGGGAAGAGGGGCCCAGG + Intronic
1093194967 12:16120028-16120050 TATGCTTTGCAGAGGGGTGCGGG + Intergenic
1100505574 12:95217358-95217380 CAGGCTGCGCCGCGGGGCGGCGG - Exonic
1101365228 12:104064530-104064552 CATTGTGGGCAGAGGGGCGGGGG + Exonic
1107508547 13:41060145-41060167 CACGCGGCGGAAAGGGGCGCCGG + Intronic
1112579904 13:100669664-100669686 GATGCTTTGCAGAGGGCCGCAGG - Intronic
1113231645 13:108218624-108218646 CAGGCTGCGCAGTCGGCCGCGGG - Exonic
1117737025 14:58777854-58777876 CATGCAGAGCAGAGGGGCAAGGG - Intergenic
1121285104 14:92729183-92729205 CAGGATGGGCAGAGGTGCGCAGG - Intronic
1122959277 14:105087238-105087260 CGTGCTGCGCCCACGGGCGCAGG + Intergenic
1123024966 14:105420133-105420155 CCTGCGGGGCAGAGGGGCGGGGG - Intronic
1123037778 14:105478431-105478453 CATGCTGCGCAGAGGGGCGCGGG - Exonic
1124404136 15:29379277-29379299 CAGGCTTCACAGAGGGGCTCAGG - Intronic
1127861585 15:62998236-62998258 CATGCTGGGCAGGTGGGGGCAGG + Intergenic
1128305085 15:66593135-66593157 CATGGTGGGAAGAGGCGCGCTGG + Intronic
1130911811 15:88276047-88276069 AATGCTGCAGAGAGGGGTGCTGG - Intergenic
1132675278 16:1118813-1118835 CAGGCTGGGCAGAGGGGCCTGGG - Intergenic
1133223219 16:4328054-4328076 CAGGAGGCGCAGAGGGGCGTGGG + Intronic
1136398048 16:30003792-30003814 CATGCTGCGCACAGTGGGGAAGG + Intronic
1137271446 16:46905010-46905032 AATGCTGCGCAGAGAGGCTGAGG + Intronic
1138605556 16:58086187-58086209 CAGGCTGCTCAGAGGGACTCAGG - Intergenic
1139847100 16:69929019-69929041 CATGCAGTGCAGAGGGTCCCAGG + Intronic
1142274092 16:89106834-89106856 CATCCTGCACAGAGGGCCGTGGG + Intronic
1143014019 17:3882287-3882309 CTTGCTGCTCAGAGGGAAGCAGG + Exonic
1144465802 17:15496259-15496281 CATGTAGCACAGAGGGGAGCAGG + Intronic
1145937044 17:28720395-28720417 CACGCTGCGGAGAGAGGGGCGGG - Intronic
1146126520 17:30235690-30235712 CTGGCTGTGCGGAGGGGCGCCGG + Exonic
1147587807 17:41662746-41662768 CCTGCTGGGCTAAGGGGCGCTGG - Intergenic
1148698809 17:49576289-49576311 GGAGCTGCGCAGAGGGGCGGGGG + Intronic
1148936309 17:51166658-51166680 CGGGCTCCGCAGAGGGACGCCGG + Exonic
1149431067 17:56595920-56595942 CAGGCTGGGCCGAGGGGCGGGGG + Intergenic
1152224326 17:79085737-79085759 GATGCTTCCCAGAGGGGCTCGGG + Intronic
1152935208 17:83132725-83132747 CAGGCTGCACCGAGGGGAGCTGG - Intergenic
1154122778 18:11665067-11665089 GATGCTGTGCAGAGGGTGGCAGG - Intergenic
1158150065 18:54357867-54357889 CATGCGCGGCAGTGGGGCGCCGG - Exonic
1158700520 18:59741737-59741759 CATGCTGAGAAGAGGGGCTTGGG - Intergenic
1158725730 18:59969760-59969782 CAGGCTGTGCAGGGGGGCGGCGG + Intergenic
1160455652 18:78997165-78997187 CATGCTGCCCAGAGGGGGGAGGG - Exonic
1161513232 19:4683161-4683183 CATGGTGTGCAGAGCGGCGGGGG - Intronic
1163276240 19:16286186-16286208 CCTGCTGTTCACAGGGGCGCTGG + Intergenic
1163424804 19:17235470-17235492 CACGCTCCGAAGAGGGCCGCGGG - Intronic
1165160057 19:33810846-33810868 CATGCTGGGCACAGGGCAGCCGG - Intronic
1165281579 19:34802780-34802802 CATGCGGCTCAGAGGGGTCCTGG - Intergenic
1166364384 19:42271053-42271075 CAGGCTGCCCAGAGGGGCAGAGG + Intronic
1167612544 19:50514388-50514410 CGTGCTGCGCAGCGGGGCTAGGG - Intronic
1167743444 19:51337960-51337982 CGTGCTGTGCAGTGGGGCGCTGG - Exonic
1168501882 19:56899780-56899802 CATGGTGCACAGTGGGGAGCCGG + Intergenic
926221263 2:10937138-10937160 CTTTCTGGGCAGAGGGGGGCAGG - Intergenic
928113928 2:28532173-28532195 CCTGTTGAGCAGAGGGGCACAGG - Exonic
929072562 2:38048473-38048495 CATGCTCCAGAGAGGGGCACAGG + Intronic
934526572 2:95055815-95055837 CAGGCTGCAGAGAGGGGCACCGG + Intergenic
937045706 2:118850319-118850341 CATGGAGCGCAGAGCGGCGCGGG - Intergenic
948080660 2:235202784-235202806 CATGCTGAGCACAGGGAAGCAGG - Intergenic
1168750409 20:277833-277855 CCTGCTGAGCAGAGGGGTGGTGG - Intronic
1168819201 20:761876-761898 CATGCCGCCCAGTGGGGCGGGGG - Intronic
1169214112 20:3783951-3783973 CATCCTGGGCAGAGGGGCCTGGG - Exonic
1169492283 20:6081458-6081480 AATGCTGCGGAGAGGGTAGCTGG + Intronic
1169908855 20:10630646-10630668 CATGCTGAGCAGAAGGGCGCTGG - Intronic
1171013908 20:21523017-21523039 TCTCCTGCTCAGAGGGGCGCAGG - Intergenic
1171185526 20:23121607-23121629 CATGGGACGCACAGGGGCGCTGG - Intergenic
1172897033 20:38307467-38307489 CATGCTACGAACAGGGGCCCAGG + Intronic
1175857839 20:62132247-62132269 CAGGCTGCGCAGATGAGTGCGGG + Intronic
1179501741 21:41813459-41813481 CCTGCTCCCCAGAGTGGCGCGGG - Intronic
1180021804 21:45133323-45133345 CATGCTGGGAAGAGGGCCACAGG - Intronic
1182331650 22:29555352-29555374 CATTCTGCCCAGAGGGGCTGGGG - Exonic
1183669004 22:39261208-39261230 CAGGCTGCACAGAGTGGAGCAGG + Intergenic
1184141475 22:42580208-42580230 CATACTGCACAGAGGTGAGCTGG - Intergenic
1184785589 22:46670143-46670165 CGTGCTGCGCAGAGGAGCAGTGG + Intronic
952816586 3:37452384-37452406 CCGGCTGCGCCGAGGGGCGCCGG + Exonic
961543687 3:127617654-127617676 CATCCTGGCCAGAGGGGCACTGG - Intronic
961555049 3:127691585-127691607 CAGGCTTTGCAGAGGGGCGGGGG - Exonic
967156367 3:186696210-186696232 AATGCTGCACAGAGGGGCCATGG - Intergenic
975556857 4:75673529-75673551 CGTGCTCCGCAGAGGGACACGGG - Exonic
978830134 4:113073800-113073822 CATGCTGCGTAGAGGCGGCCTGG - Intronic
980988632 4:139719024-139719046 CATGCTGGGCAGAGGGGCTCTGG + Exonic
988487932 5:31682213-31682235 CAAGCTTCGCAGAGGGGCTTAGG + Intronic
990552742 5:56900356-56900378 CATGCTGAGAAGAGTGGAGCGGG - Intergenic
992774004 5:80073897-80073919 CATGCTTCACAGATGGGCTCTGG + Intronic
998134113 5:139665754-139665776 CAAGCTGGGCAGAGGGACCCCGG + Intronic
998316087 5:141184176-141184198 CGCGCTGAGCAGAGAGGCGCTGG + Exonic
998317276 5:141194169-141194191 CGCGCTGAGCAGAGAGGCGCTGG + Exonic
1002363402 5:178691854-178691876 CATGCTGTGCAGAGGGGCCCTGG + Intergenic
1002633769 5:180597051-180597073 CCTGCTGTGCGGAGGGGAGCAGG + Intergenic
1002785889 6:399768-399790 TTTGCTGCTCAGAGGGGAGCTGG + Intronic
1003435376 6:6083170-6083192 CATGCTTCCCAGATGGGAGCTGG - Intergenic
1004441887 6:15662420-15662442 TCTGCTGGGCCGAGGGGCGCAGG + Intronic
1015976510 6:138796296-138796318 TAAGCAGCGCTGAGGGGCGCAGG + Intronic
1017253039 6:152302235-152302257 CAGGCTGCGCGGCGCGGCGCAGG + Intronic
1018092710 6:160358836-160358858 CAGTCTGAGCAGAGGGACGCTGG + Intronic
1019689717 7:2403761-2403783 CGGGCCGCGCTGAGGGGCGCGGG + Intronic
1021992734 7:26152940-26152962 CAGGCTGTGCAGGGGGGCGGCGG + Exonic
1022923428 7:35037713-35037735 CGTCCGGCGCAGAGGGGCGGCGG - Intronic
1024062519 7:45709614-45709636 CATCCTGGGCAGTGGGGAGCTGG - Intronic
1027138179 7:75639153-75639175 CATGCTGCGGGGAGGGCGGCCGG + Intronic
1030086532 7:105820406-105820428 CATGCTGGGCAGTGGGGTGAAGG + Intronic
1032215330 7:129952812-129952834 CGCGCGGCGCAGAGGAGCGCCGG - Exonic
1033930169 7:146509920-146509942 CATGCTGCTAAGATGGGCCCTGG - Intronic
1034441366 7:151087439-151087461 CCTGCTCCGCAGTGGGGCGGGGG + Intronic
1034509284 7:151520666-151520688 GGTGCAGTGCAGAGGGGCGCGGG + Intergenic
1035167550 7:157000488-157000510 AGTGCGGCGCGGAGGGGCGCTGG - Intronic
1035545748 8:481031-481053 CCTGCTGTGCACAGGGGCCCAGG + Intergenic
1036824718 8:11967116-11967138 CATGCTGCTCCCAGGGCCGCTGG - Intergenic
1037817798 8:22120955-22120977 CATCCTGCAGAGAGGGGCACAGG + Exonic
1039305047 8:36252198-36252220 CATGCTGCTCAGAGGGATTCTGG - Intergenic
1042390788 8:68231121-68231143 CAAGCTATGCAGAGGGGCACTGG + Intronic
1042400600 8:68341677-68341699 CAGGATGGGCAGAGGGGCACAGG - Intronic
1048439288 8:134448041-134448063 CATGATGCCCAGAGGGTCTCTGG - Intergenic
1048987082 8:139740460-139740482 CATGCTGGGCAGGGGGAGGCAGG + Intronic
1049238132 8:141522981-141523003 CTTGCTGAGCAGAGGGGCTGGGG + Intergenic
1049323876 8:142011781-142011803 CATGCTGCACAGAGGTGCTCCGG + Intergenic
1061782492 9:133004220-133004242 CAGGCCGGGCTGAGGGGCGCTGG - Intergenic
1062497224 9:136837585-136837607 GATGCTGCGCCGTGGGGCGGGGG - Exonic
1062637993 9:137501508-137501530 CATGGTGCCCAGAGGGGCAGTGG + Intronic
1187469170 X:19552983-19553005 CATGCTGGGCTGAGGAGTGCTGG + Intronic
1188558188 X:31435788-31435810 CATGCAGCGCAGCGGGGCAGTGG + Intronic
1190212967 X:48461921-48461943 CATCCTGCTCAGAGTGGAGCTGG - Intronic
1190333830 X:49251120-49251142 AAGGCTGCTCAGAGGGGCCCCGG - Exonic