ID: 1123037941

View in Genome Browser
Species Human (GRCh38)
Location 14:105478901-105478923
Sequence TTGTGGGCACGCGCGGGCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 110}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123037924_1123037941 16 Left 1123037924 14:105478862-105478884 CCCAGCAGAGGTGGGCTGGGCGC 0: 1
1: 0
2: 3
3: 20
4: 237
Right 1123037941 14:105478901-105478923 TTGTGGGCACGCGCGGGCTGGGG 0: 1
1: 0
2: 0
3: 5
4: 110
1123037925_1123037941 15 Left 1123037925 14:105478863-105478885 CCAGCAGAGGTGGGCTGGGCGCG 0: 1
1: 0
2: 2
3: 26
4: 241
Right 1123037941 14:105478901-105478923 TTGTGGGCACGCGCGGGCTGGGG 0: 1
1: 0
2: 0
3: 5
4: 110
1123037918_1123037941 26 Left 1123037918 14:105478852-105478874 CCCGAAGGGGCCCAGCAGAGGTG 0: 1
1: 0
2: 2
3: 22
4: 210
Right 1123037941 14:105478901-105478923 TTGTGGGCACGCGCGGGCTGGGG 0: 1
1: 0
2: 0
3: 5
4: 110
1123037915_1123037941 28 Left 1123037915 14:105478850-105478872 CCCCCGAAGGGGCCCAGCAGAGG 0: 1
1: 0
2: 0
3: 11
4: 164
Right 1123037941 14:105478901-105478923 TTGTGGGCACGCGCGGGCTGGGG 0: 1
1: 0
2: 0
3: 5
4: 110
1123037917_1123037941 27 Left 1123037917 14:105478851-105478873 CCCCGAAGGGGCCCAGCAGAGGT 0: 1
1: 0
2: 1
3: 13
4: 146
Right 1123037941 14:105478901-105478923 TTGTGGGCACGCGCGGGCTGGGG 0: 1
1: 0
2: 0
3: 5
4: 110
1123037919_1123037941 25 Left 1123037919 14:105478853-105478875 CCGAAGGGGCCCAGCAGAGGTGG 0: 1
1: 0
2: 2
3: 39
4: 285
Right 1123037941 14:105478901-105478923 TTGTGGGCACGCGCGGGCTGGGG 0: 1
1: 0
2: 0
3: 5
4: 110
1123037914_1123037941 29 Left 1123037914 14:105478849-105478871 CCCCCCGAAGGGGCCCAGCAGAG 0: 1
1: 0
2: 0
3: 6
4: 155
Right 1123037941 14:105478901-105478923 TTGTGGGCACGCGCGGGCTGGGG 0: 1
1: 0
2: 0
3: 5
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123037941 Original CRISPR TTGTGGGCACGCGCGGGCTG GGG Intronic
900671440 1:3857248-3857270 TTGTGCGCAGGCGCGGCCTGGGG - Intronic
901762661 1:11480662-11480684 GTGTGTGCACGCGCGCGCTGGGG - Intronic
901801049 1:11708157-11708179 TAGAGGGCACGCGTGGGGTGTGG + Intronic
902581527 1:17410696-17410718 ATGTGGGCAGGCCTGGGCTGGGG - Intronic
902958224 1:19941599-19941621 TTCTAGGCACTGGCGGGCTGGGG - Intergenic
904498424 1:30900688-30900710 TTGCGGGCACCAGGGGGCTGTGG - Intronic
905629105 1:39509017-39509039 CTGTGGGGACGCCCGTGCTGTGG - Intronic
905833798 1:41098771-41098793 TTGTGGGCTGGCGGGGGGTGGGG - Intronic
912670613 1:111620423-111620445 TTTTGGGCCCGCGGGGGCGGGGG + Intronic
914802997 1:150974285-150974307 AGGTGGGGACGCGGGGGCTGCGG - Intronic
915544944 1:156591845-156591867 TTGCGGGCTCGCGCGTGCCGCGG + Exonic
923333951 1:232950783-232950805 GGGTGGGGGCGCGCGGGCTGCGG + Intronic
1064430622 10:15267202-15267224 CTGTGGGCACGCATGGGCAGGGG + Intronic
1070480404 10:76876968-76876990 TTGTGGGCACACCTGGGATGTGG - Intronic
1072930710 10:99659593-99659615 GTGTGGGCGCGAGAGGGCTGTGG + Intronic
1076792526 10:132784899-132784921 TTGTGAGGACCCGCGGGGTGGGG - Exonic
1076795020 10:132794185-132794207 TTGTGGGGAGGCACTGGCTGTGG - Intergenic
1076911781 10:133394075-133394097 TCGTGCGCACGCGCAGGCCGTGG + Intronic
1084477871 11:69399052-69399074 CTGTGGGCACGTGAGGGGTGGGG - Intergenic
1085165897 11:74398757-74398779 TTGGGGGCACGCGCCGGTTGGGG + Intergenic
1085253496 11:75159250-75159272 TTGCGGGCCAGCTCGGGCTGTGG + Intronic
1094564874 12:31590632-31590654 CTGTGGGGACGCGCGGGAGGCGG - Intronic
1097895844 12:64824507-64824529 TTCTGGGCACGGGGGAGCTGGGG + Intronic
1107359462 13:39603140-39603162 CTGTGGGCGCGCGCGGGCGCCGG + Exonic
1113681091 13:112245630-112245652 TCCAGGGCACGCGAGGGCTGTGG - Intergenic
1113764950 13:112875278-112875300 CTGTGGGCTCGGGCTGGCTGCGG + Intronic
1113907041 13:113824214-113824236 TCGGGAGCACGCGCGGTCTGGGG + Intronic
1113907054 13:113824278-113824300 TCGGGAGCACGCGCGGTCTGGGG + Intronic
1114648720 14:24269907-24269929 ATGTGGGCAGGTGAGGGCTGTGG + Intronic
1117880522 14:60308942-60308964 TTGTGGGCAAGTGGGGGTTGGGG + Intergenic
1119453635 14:74735136-74735158 TTGTGGGGCCGCGGGGGTTGGGG + Exonic
1121011883 14:90524624-90524646 TTTTGGGCAGGCGGTGGCTGTGG - Exonic
1122106368 14:99459954-99459976 TTGTGGGGAGGCGAGGGTTGGGG - Intronic
1122550171 14:102545110-102545132 AGGTGCGCACGCGCGGGGTGGGG - Intergenic
1122620824 14:103056928-103056950 GCGTGGGGATGCGCGGGCTGGGG + Intronic
1122981932 14:105195975-105195997 TGGTGGGCACCGGTGGGCTGTGG + Intergenic
1123037941 14:105478901-105478923 TTGTGGGCACGCGCGGGCTGGGG + Intronic
1127969443 15:63946980-63947002 TTGTGGGGAGGGGCTGGCTGTGG - Intronic
1130002580 15:80059965-80059987 TGGTGGGCCCGCGGGGGCCGCGG + Intronic
1132522305 16:397381-397403 GTGCGCGCACGTGCGGGCTGGGG + Intronic
1135296443 16:21283649-21283671 TTGGGAGCATGCGCGGGGTGGGG + Intronic
1136073843 16:27804943-27804965 TTGGGGGCACGGGAGCGCTGTGG + Intronic
1136540004 16:30923810-30923832 TCGGGGGTGCGCGCGGGCTGGGG + Intronic
1137499724 16:49001206-49001228 TTGTGGGCAGGGTGGGGCTGCGG - Intergenic
1138023214 16:53503101-53503123 TGGTGGGTACGCGAGGGCTGAGG - Intronic
1139705442 16:68737726-68737748 GGGTGGGCTCGCGCGGGCGGTGG + Intronic
1141298218 16:82789877-82789899 TTGTGGGCACGCTCCTGCGGAGG + Intronic
1142979458 17:3663316-3663338 GTGTGGACACACGAGGGCTGGGG + Exonic
1144757148 17:17686603-17686625 GTGTGTGCACGCGCGCGCCGGGG + Intronic
1145207535 17:20992590-20992612 ACGTGGGCACGGGCGGGCAGGGG - Intergenic
1146058594 17:29593202-29593224 CTGTGGGGACCCGGGGGCTGCGG + Intronic
1146371108 17:32266040-32266062 ATGGGGGCGGGCGCGGGCTGCGG + Intergenic
1152364007 17:79844825-79844847 TTGGGGGCTCGGGGGGGCTGGGG - Intergenic
1152604496 17:81282360-81282382 TGGTGAGCAGGCACGGGCTGTGG - Intronic
1152656021 17:81519565-81519587 TCCTGGGCAGGCGCGGGCTCCGG - Intronic
1154019233 18:10648061-10648083 TTGGGGGCACTGGCGGGCTCAGG - Intergenic
1156350210 18:36296938-36296960 TTGTGGGGCCGCGGGGGCTTGGG - Intergenic
1157263890 18:46200086-46200108 GTGTGTGCGCGCGCGTGCTGGGG + Intronic
1161617837 19:5282023-5282045 TTCTGGGGACGCCCAGGCTGCGG - Intronic
1161952122 19:7473417-7473439 TTTTGGGGAGGCGGGGGCTGAGG + Intergenic
1162340059 19:10086727-10086749 TTGGGGGAAGGCGCGGACTGGGG - Intronic
1165106736 19:33474566-33474588 TAGTGGGGAGGCGGGGGCTGAGG + Intronic
1165901853 19:39173029-39173051 TGGCGGGCACGGGCGGGCGGCGG - Exonic
1166838809 19:45683657-45683679 TTGTGGGTTCTCGCGGGGTGGGG + Exonic
927000873 2:18792942-18792964 GTGTGTGCACGCGCGCGCAGTGG - Intergenic
930937436 2:56970728-56970750 CTGAGGGCACGTGCTGGCTGGGG - Intergenic
946427748 2:219608440-219608462 TTGTGGGCTGGGGCGAGCTGAGG + Intronic
948293874 2:236846865-236846887 ATGAGGGCACGCTCTGGCTGTGG + Intergenic
1172452782 20:35040078-35040100 TTGTGGGGGCGCGGGGGGTGGGG - Intronic
1175751612 20:61501990-61502012 TAGTGGGCGCGTGAGGGCTGTGG + Intronic
1175776347 20:61656235-61656257 GGGTGGGCAGGCGCGTGCTGGGG + Intronic
1175776353 20:61656255-61656277 GGGTGGGCAGGCGCGTGCTGGGG + Intronic
1175776359 20:61656275-61656297 GGGTGGGCAGGCGCGTGCTGGGG + Intronic
1175776368 20:61656315-61656337 AAGTGGGCAGGCGCGTGCTGGGG + Intronic
1175776377 20:61656355-61656377 AAGTGGGCAGGCGCGTGCTGGGG + Intronic
1176276015 20:64269816-64269838 ATGTGGGCACGCGTGGTGTGGGG + Intronic
1179950827 21:44707992-44708014 GTGTGTGCACGCGCGGGGCGGGG - Intronic
1181668666 22:24415246-24415268 GTGCGGGCACGCCAGGGCTGGGG + Exonic
1182093971 22:27614089-27614111 GTGTGGCCACACGTGGGCTGGGG + Intergenic
949365087 3:3271988-3272010 TTGTGGGGAAGCGCTGGCTGAGG - Intergenic
949549387 3:5099640-5099662 TGGTGGACAGGCGCAGGCTGGGG + Intergenic
951544479 3:23810791-23810813 TCGGGGGCGCGCGCGGGGTGGGG + Intronic
955079023 3:55640600-55640622 TTGTGGGAACACGGAGGCTGTGG + Intronic
960958077 3:123049026-123049048 TTGTTGGCACCCATGGGCTGAGG - Intergenic
962255620 3:133868187-133868209 TTGAGGGCAGGTGTGGGCTGAGG - Intronic
963525022 3:146406413-146406435 TTGTGGGTACGGGCTGGCTCTGG + Intronic
963606746 3:147419219-147419241 ATGTGCGCATGCGCGGCCTGTGG + Intronic
969217645 4:5734998-5735020 CTGTGGACACTCGCTGGCTGTGG - Intronic
969379015 4:6782515-6782537 CTGCGGGCGCGCGCGGGCGGTGG - Intronic
988066906 5:26235730-26235752 TTGTGGGCAGGTGTGGGCTCAGG + Intergenic
989212027 5:38866055-38866077 ATGTGGGCACCAGCAGGCTGGGG + Intronic
994072798 5:95620747-95620769 GCGAGGGCACGCGCGGGCAGCGG - Exonic
1003859266 6:10307374-10307396 GTGTGGGCTCTCGCGGGCTCTGG + Intergenic
1008952052 6:57172281-57172303 CTGTGGGTCCGCGCGGGCTTCGG + Intergenic
1013099405 6:106974611-106974633 TGGTGGCCAGGCTCGGGCTGGGG - Intronic
1020077083 7:5265272-5265294 TGGTGGGCACACGCCCGCTGTGG + Intergenic
1020143505 7:5625108-5625130 GTGTGGGCCCGAGGGGGCTGAGG + Intronic
1021107625 7:16656540-16656562 GTGTGTGCGCGCGCGCGCTGGGG - Intronic
1024043643 7:45573810-45573832 CTGTGGGCGGGTGCGGGCTGCGG - Intergenic
1029092355 7:98058148-98058170 TTGTGGGGACTTGGGGGCTGGGG - Intergenic
1029448275 7:100626907-100626929 GGGTGGGGAGGCGCGGGCTGGGG + Intronic
1035726245 8:1825528-1825550 TCTTGGGCACCAGCGGGCTGTGG - Intronic
1038205022 8:25458072-25458094 AGGTGGGCGTGCGCGGGCTGGGG - Intronic
1046094345 8:109539853-109539875 TTGTGTGCGCGCGCGGCCCGCGG + Intronic
1048296852 8:133220846-133220868 GTGTGGGCCCGAGTGGGCTGGGG + Intronic
1049487668 8:142874936-142874958 ATGTGAGCAGGCCCGGGCTGGGG - Exonic
1061450961 9:130666793-130666815 TGGGAGGTACGCGCGGGCTGGGG + Exonic
1061707582 9:132464721-132464743 TAGTGGCCACACGTGGGCTGTGG + Intronic
1062366211 9:136210370-136210392 GTGGGGGCACATGCGGGCTGGGG + Intronic
1190302274 X:49063937-49063959 TGGAGGGTAGGCGCGGGCTGTGG - Exonic
1190726674 X:53194588-53194610 GTGTGGGCAGGTGCTGGCTGGGG - Exonic
1195668472 X:107450311-107450333 TTGTGTGCGCGCCTGGGCTGTGG + Intergenic
1196613846 X:117744047-117744069 TTATGGGCAAGAGCTGGCTGTGG - Intergenic
1198683506 X:139205061-139205083 GTGTGGGCACGCGGAGGGTGGGG + Intronic
1198833479 X:140776533-140776555 GGGTGGTCACGCGCGGGCTTGGG - Intergenic
1199935216 X:152566872-152566894 TTGTGGGCACTCGTGGAGTGAGG - Intergenic