ID: 1123038360

View in Genome Browser
Species Human (GRCh38)
Location 14:105480410-105480432
Sequence CTGTGGGGAGGTAAGGAAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123038343_1123038360 29 Left 1123038343 14:105480358-105480380 CCGGTTTGGGTGGTGGTGCCCAC No data
Right 1123038360 14:105480410-105480432 CTGTGGGGAGGTAAGGAAGGTGG No data
1123038351_1123038360 6 Left 1123038351 14:105480381-105480403 CCAGATGGGGAGGCAGTAAGAAC No data
Right 1123038360 14:105480410-105480432 CTGTGGGGAGGTAAGGAAGGTGG No data
1123038349_1123038360 10 Left 1123038349 14:105480377-105480399 CCACCCAGATGGGGAGGCAGTAA No data
Right 1123038360 14:105480410-105480432 CTGTGGGGAGGTAAGGAAGGTGG No data
1123038348_1123038360 11 Left 1123038348 14:105480376-105480398 CCCACCCAGATGGGGAGGCAGTA No data
Right 1123038360 14:105480410-105480432 CTGTGGGGAGGTAAGGAAGGTGG No data
1123038350_1123038360 7 Left 1123038350 14:105480380-105480402 CCCAGATGGGGAGGCAGTAAGAA No data
Right 1123038360 14:105480410-105480432 CTGTGGGGAGGTAAGGAAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123038360 Original CRISPR CTGTGGGGAGGTAAGGAAGG TGG Intergenic
No off target data available for this crispr