ID: 1123038887

View in Genome Browser
Species Human (GRCh38)
Location 14:105482434-105482456
Sequence ACCAGGGCCTTGTGGATCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123038887_1123038897 5 Left 1123038887 14:105482434-105482456 CCAGGGATCCACAAGGCCCTGGT No data
Right 1123038897 14:105482462-105482484 ATGGGGCTAAGCTCACACCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123038887 Original CRISPR ACCAGGGCCTTGTGGATCCC TGG (reversed) Intergenic
No off target data available for this crispr