ID: 1123038913

View in Genome Browser
Species Human (GRCh38)
Location 14:105482541-105482563
Sequence GGGACCTGGCCAGGAGACAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123038913_1123038923 9 Left 1123038913 14:105482541-105482563 CCCGTGTCTCCTGGCCAGGTCCC No data
Right 1123038923 14:105482573-105482595 TCCCCCACTCCAACCTGGGCTGG No data
1123038913_1123038927 12 Left 1123038913 14:105482541-105482563 CCCGTGTCTCCTGGCCAGGTCCC No data
Right 1123038927 14:105482576-105482598 CCCACTCCAACCTGGGCTGGTGG No data
1123038913_1123038929 13 Left 1123038913 14:105482541-105482563 CCCGTGTCTCCTGGCCAGGTCCC No data
Right 1123038929 14:105482577-105482599 CCACTCCAACCTGGGCTGGTGGG No data
1123038913_1123038921 4 Left 1123038913 14:105482541-105482563 CCCGTGTCTCCTGGCCAGGTCCC No data
Right 1123038921 14:105482568-105482590 AGGTATCCCCCACTCCAACCTGG No data
1123038913_1123038922 5 Left 1123038913 14:105482541-105482563 CCCGTGTCTCCTGGCCAGGTCCC No data
Right 1123038922 14:105482569-105482591 GGTATCCCCCACTCCAACCTGGG No data
1123038913_1123038930 14 Left 1123038913 14:105482541-105482563 CCCGTGTCTCCTGGCCAGGTCCC No data
Right 1123038930 14:105482578-105482600 CACTCCAACCTGGGCTGGTGGGG No data
1123038913_1123038933 24 Left 1123038913 14:105482541-105482563 CCCGTGTCTCCTGGCCAGGTCCC No data
Right 1123038933 14:105482588-105482610 TGGGCTGGTGGGGCCCTCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123038913 Original CRISPR GGGACCTGGCCAGGAGACAC GGG (reversed) Intergenic
No off target data available for this crispr