ID: 1123038921

View in Genome Browser
Species Human (GRCh38)
Location 14:105482568-105482590
Sequence AGGTATCCCCCACTCCAACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123038909_1123038921 19 Left 1123038909 14:105482526-105482548 CCACTGTCCAGTCTTCCCGTGTC No data
Right 1123038921 14:105482568-105482590 AGGTATCCCCCACTCCAACCTGG No data
1123038907_1123038921 21 Left 1123038907 14:105482524-105482546 CCCCACTGTCCAGTCTTCCCGTG No data
Right 1123038921 14:105482568-105482590 AGGTATCCCCCACTCCAACCTGG No data
1123038917_1123038921 -10 Left 1123038917 14:105482555-105482577 CCAGGTCCCTCCAAGGTATCCCC No data
Right 1123038921 14:105482568-105482590 AGGTATCCCCCACTCCAACCTGG No data
1123038906_1123038921 22 Left 1123038906 14:105482523-105482545 CCCCCACTGTCCAGTCTTCCCGT No data
Right 1123038921 14:105482568-105482590 AGGTATCCCCCACTCCAACCTGG No data
1123038913_1123038921 4 Left 1123038913 14:105482541-105482563 CCCGTGTCTCCTGGCCAGGTCCC No data
Right 1123038921 14:105482568-105482590 AGGTATCCCCCACTCCAACCTGG No data
1123038908_1123038921 20 Left 1123038908 14:105482525-105482547 CCCACTGTCCAGTCTTCCCGTGT No data
Right 1123038921 14:105482568-105482590 AGGTATCCCCCACTCCAACCTGG No data
1123038914_1123038921 3 Left 1123038914 14:105482542-105482564 CCGTGTCTCCTGGCCAGGTCCCT No data
Right 1123038921 14:105482568-105482590 AGGTATCCCCCACTCCAACCTGG No data
1123038911_1123038921 12 Left 1123038911 14:105482533-105482555 CCAGTCTTCCCGTGTCTCCTGGC No data
Right 1123038921 14:105482568-105482590 AGGTATCCCCCACTCCAACCTGG No data
1123038916_1123038921 -5 Left 1123038916 14:105482550-105482572 CCTGGCCAGGTCCCTCCAAGGTA No data
Right 1123038921 14:105482568-105482590 AGGTATCCCCCACTCCAACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123038921 Original CRISPR AGGTATCCCCCACTCCAACC TGG Intergenic
No off target data available for this crispr