ID: 1123038930

View in Genome Browser
Species Human (GRCh38)
Location 14:105482578-105482600
Sequence CACTCCAACCTGGGCTGGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123038914_1123038930 13 Left 1123038914 14:105482542-105482564 CCGTGTCTCCTGGCCAGGTCCCT No data
Right 1123038930 14:105482578-105482600 CACTCCAACCTGGGCTGGTGGGG No data
1123038917_1123038930 0 Left 1123038917 14:105482555-105482577 CCAGGTCCCTCCAAGGTATCCCC No data
Right 1123038930 14:105482578-105482600 CACTCCAACCTGGGCTGGTGGGG No data
1123038909_1123038930 29 Left 1123038909 14:105482526-105482548 CCACTGTCCAGTCTTCCCGTGTC No data
Right 1123038930 14:105482578-105482600 CACTCCAACCTGGGCTGGTGGGG No data
1123038920_1123038930 -10 Left 1123038920 14:105482565-105482587 CCAAGGTATCCCCCACTCCAACC No data
Right 1123038930 14:105482578-105482600 CACTCCAACCTGGGCTGGTGGGG No data
1123038911_1123038930 22 Left 1123038911 14:105482533-105482555 CCAGTCTTCCCGTGTCTCCTGGC No data
Right 1123038930 14:105482578-105482600 CACTCCAACCTGGGCTGGTGGGG No data
1123038913_1123038930 14 Left 1123038913 14:105482541-105482563 CCCGTGTCTCCTGGCCAGGTCCC No data
Right 1123038930 14:105482578-105482600 CACTCCAACCTGGGCTGGTGGGG No data
1123038916_1123038930 5 Left 1123038916 14:105482550-105482572 CCTGGCCAGGTCCCTCCAAGGTA No data
Right 1123038930 14:105482578-105482600 CACTCCAACCTGGGCTGGTGGGG No data
1123038918_1123038930 -6 Left 1123038918 14:105482561-105482583 CCCTCCAAGGTATCCCCCACTCC No data
Right 1123038930 14:105482578-105482600 CACTCCAACCTGGGCTGGTGGGG No data
1123038919_1123038930 -7 Left 1123038919 14:105482562-105482584 CCTCCAAGGTATCCCCCACTCCA No data
Right 1123038930 14:105482578-105482600 CACTCCAACCTGGGCTGGTGGGG No data
1123038908_1123038930 30 Left 1123038908 14:105482525-105482547 CCCACTGTCCAGTCTTCCCGTGT No data
Right 1123038930 14:105482578-105482600 CACTCCAACCTGGGCTGGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123038930 Original CRISPR CACTCCAACCTGGGCTGGTG GGG Intergenic
No off target data available for this crispr