ID: 1123038933

View in Genome Browser
Species Human (GRCh38)
Location 14:105482588-105482610
Sequence TGGGCTGGTGGGGCCCTCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123038913_1123038933 24 Left 1123038913 14:105482541-105482563 CCCGTGTCTCCTGGCCAGGTCCC No data
Right 1123038933 14:105482588-105482610 TGGGCTGGTGGGGCCCTCACTGG No data
1123038925_1123038933 -10 Left 1123038925 14:105482575-105482597 CCCCACTCCAACCTGGGCTGGTG No data
Right 1123038933 14:105482588-105482610 TGGGCTGGTGGGGCCCTCACTGG No data
1123038919_1123038933 3 Left 1123038919 14:105482562-105482584 CCTCCAAGGTATCCCCCACTCCA No data
Right 1123038933 14:105482588-105482610 TGGGCTGGTGGGGCCCTCACTGG No data
1123038914_1123038933 23 Left 1123038914 14:105482542-105482564 CCGTGTCTCCTGGCCAGGTCCCT No data
Right 1123038933 14:105482588-105482610 TGGGCTGGTGGGGCCCTCACTGG No data
1123038924_1123038933 -9 Left 1123038924 14:105482574-105482596 CCCCCACTCCAACCTGGGCTGGT No data
Right 1123038933 14:105482588-105482610 TGGGCTGGTGGGGCCCTCACTGG No data
1123038918_1123038933 4 Left 1123038918 14:105482561-105482583 CCCTCCAAGGTATCCCCCACTCC No data
Right 1123038933 14:105482588-105482610 TGGGCTGGTGGGGCCCTCACTGG No data
1123038917_1123038933 10 Left 1123038917 14:105482555-105482577 CCAGGTCCCTCCAAGGTATCCCC No data
Right 1123038933 14:105482588-105482610 TGGGCTGGTGGGGCCCTCACTGG No data
1123038920_1123038933 0 Left 1123038920 14:105482565-105482587 CCAAGGTATCCCCCACTCCAACC No data
Right 1123038933 14:105482588-105482610 TGGGCTGGTGGGGCCCTCACTGG No data
1123038916_1123038933 15 Left 1123038916 14:105482550-105482572 CCTGGCCAGGTCCCTCCAAGGTA No data
Right 1123038933 14:105482588-105482610 TGGGCTGGTGGGGCCCTCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123038933 Original CRISPR TGGGCTGGTGGGGCCCTCAC TGG Intergenic
No off target data available for this crispr