ID: 1123040069

View in Genome Browser
Species Human (GRCh38)
Location 14:105486825-105486847
Sequence CGGGCGGGTGCCGGTGGGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 471
Summary {0: 1, 1: 0, 2: 0, 3: 42, 4: 428}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123040058_1123040069 1 Left 1123040058 14:105486801-105486823 CCTGGCCCGGGCAGATCTGGGGT 0: 1
1: 0
2: 1
3: 22
4: 229
Right 1123040069 14:105486825-105486847 CGGGCGGGTGCCGGTGGGGTAGG 0: 1
1: 0
2: 0
3: 42
4: 428
1123040062_1123040069 -5 Left 1123040062 14:105486807-105486829 CCGGGCAGATCTGGGGTTCGGGC 0: 1
1: 0
2: 1
3: 12
4: 138
Right 1123040069 14:105486825-105486847 CGGGCGGGTGCCGGTGGGGTAGG 0: 1
1: 0
2: 0
3: 42
4: 428
1123040060_1123040069 -4 Left 1123040060 14:105486806-105486828 CCCGGGCAGATCTGGGGTTCGGG 0: 1
1: 0
2: 3
3: 23
4: 229
Right 1123040069 14:105486825-105486847 CGGGCGGGTGCCGGTGGGGTAGG 0: 1
1: 0
2: 0
3: 42
4: 428
1123040054_1123040069 6 Left 1123040054 14:105486796-105486818 CCAGTCCTGGCCCGGGCAGATCT 0: 1
1: 0
2: 2
3: 10
4: 231
Right 1123040069 14:105486825-105486847 CGGGCGGGTGCCGGTGGGGTAGG 0: 1
1: 0
2: 0
3: 42
4: 428

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123040069 Original CRISPR CGGGCGGGTGCCGGTGGGGT AGG Intergenic
900161276 1:1225158-1225180 CGGGCGGCTGCAGCAGGGGTAGG - Intronic
900601150 1:3503178-3503200 TGGGCGGGTGCCCCTGGGGATGG - Intronic
900602687 1:3509766-3509788 CAGGCAGGTGGGGGTGGGGTGGG + Intronic
900621844 1:3591128-3591150 GGCGCGGCTGCTGGTGGGGTCGG - Intronic
900671674 1:3858192-3858214 GGGGTCGGTGCGGGTGGGGTGGG + Intronic
901016622 1:6235677-6235699 CCGGCGGGGGCCGGCGGGGCGGG - Intronic
901109870 1:6785711-6785733 GGGGAGGGGGCCGGCGGGGTGGG + Intronic
901109912 1:6785811-6785833 CGGGCTGGGGCCGGAGGGGGCGG + Intronic
901426193 1:9183342-9183364 CGGTCGGGCGCCCTTGGGGTGGG + Intergenic
901635383 1:10667972-10667994 AGGGCAGGTGCCGGGGGAGTCGG - Intronic
901641114 1:10693754-10693776 CGGGTGGGGGCCGGGAGGGTCGG - Intronic
902226560 1:14999901-14999923 AGGGCAGGGGCTGGTGGGGTGGG + Intronic
902990795 1:20186003-20186025 CGGGTGGGGTCGGGTGGGGTCGG - Intergenic
903263564 1:22143510-22143532 CCGGCGGGGGGCGGTGGGGGGGG - Intronic
904463727 1:30695619-30695641 GGGGTGGGTGGGGGTGGGGTGGG - Intergenic
904769420 1:32872546-32872568 GGGGCGGGGCCGGGTGGGGTGGG - Intergenic
905539325 1:38747448-38747470 GGGGTGGGTGCGGGTGGGGCAGG + Intergenic
913022768 1:114804507-114804529 CGGGAGGGAGGCGGTGGGGAGGG - Intergenic
914226129 1:145721000-145721022 GGGGAGGGTGCCCGTGGAGTTGG - Intronic
915079488 1:153342041-153342063 CTGGCGGGTGCTGCTGGGCTTGG - Intronic
915579897 1:156807267-156807289 CGGGTGGGGGCTGGTGGGGCAGG + Exonic
915726534 1:158022031-158022053 TGGGTGGGTGCGGTTGGGGTGGG + Intronic
917310072 1:173669626-173669648 CTTGCGGCTGCCGGCGGGGTAGG + Intronic
917738512 1:177941681-177941703 TGGGCGGGTGGTGGTGGGATTGG - Intronic
918215940 1:182391928-182391950 CCGGCGGGCGCCGCTGGGGTGGG + Exonic
921089551 1:211830377-211830399 CGGGCGGGTCCCGGGGAGGCGGG + Intronic
922603772 1:226876086-226876108 CGGGCAGGTGGGGGTGGGGCTGG - Intronic
922958550 1:229625800-229625822 CGGGCGGGGGCCGGGGCGGTGGG - Intronic
1062855362 10:777405-777427 CGGGGGGAGGCCTGTGGGGTCGG - Intergenic
1062855399 10:777502-777524 CGGGGGGAGGCCTGTGGGGTCGG - Intergenic
1062855436 10:777602-777624 CGGGGGGAGGCCTGTGGGGTCGG - Intergenic
1062855454 10:777651-777673 CGGGGGGAGGCCTGTGGGGTCGG - Intergenic
1062855472 10:777700-777722 CGGGGGGAGGCCTGTGGGGTCGG - Intergenic
1062855490 10:777749-777771 CGGGGGGAGGCCTGTGGGGTCGG - Intergenic
1062855508 10:777798-777820 CGGGGGGAGGCCTGTGGGGTCGG - Intergenic
1062855526 10:777847-777869 CGGGGGGAGGCCTGTGGGGTCGG - Intergenic
1062855544 10:777896-777918 CGGGGGGAGGCCTGTGGGGTCGG - Intergenic
1064131559 10:12714200-12714222 GTGGGGGGTGACGGTGGGGTCGG - Intronic
1065025189 10:21534380-21534402 CGGCCGGGTGGAGGTGGGGAGGG + Exonic
1065056971 10:21855781-21855803 GGGCAGGGTGGCGGTGGGGTAGG - Intronic
1065845136 10:29737044-29737066 CGGGCGCGCGCCGAGGGGGTGGG - Intergenic
1066453074 10:35549095-35549117 GGGGCGGGGGGGGGTGGGGTGGG - Intronic
1067691967 10:48507897-48507919 CTGGGGGGTGGGGGTGGGGTGGG + Intronic
1069024047 10:63521338-63521360 CGGGCGGGGGCGGGCGGGGACGG + Intergenic
1069892753 10:71662272-71662294 CTGGCGGGTGCTGATTGGGTTGG - Intronic
1069991912 10:72321333-72321355 CGGGGGGGTCCGGGTGGGGGAGG + Intergenic
1071544777 10:86521312-86521334 CGGGAGGGAGCCGGGAGGGTGGG - Intronic
1071997808 10:91163820-91163842 CGCGCGCGTGCCGGGGTGGTGGG + Intronic
1072283821 10:93894257-93894279 CGAGCGGGCGCCGGCGGGTTGGG + Intronic
1072970134 10:100010042-100010064 GGGGCGGGCGCCGGAGAGGTGGG - Intergenic
1073117584 10:101100422-101100444 TGGGCTGGTGCCGGTGGGGCAGG - Intronic
1073449975 10:103603435-103603457 CCGGCGAGGGCCGGTGGGGCTGG + Exonic
1073578289 10:104642378-104642400 AGGGGGGGTGGGGGTGGGGTGGG - Intronic
1075334238 10:121597488-121597510 CGGGAGGGGGCCGCTGGGGTGGG - Intronic
1075801844 10:125159401-125159423 CGGGCGGGGGCCGGGCGGGCCGG - Intronic
1076182709 10:128422885-128422907 TGGGCAGGTGCCAGCGGGGTGGG + Intergenic
1076404671 10:130203875-130203897 CGGGCGGGGGCGGGCGGGGGCGG - Intergenic
1076404677 10:130203885-130203907 CGGGCGGGGGCGGGCGGGGGCGG - Intergenic
1076949163 10:133668905-133668927 CGGGCGGGCGACGGTGGCGCGGG - Intronic
1076950147 10:133672204-133672226 CGGGCGGGCGACGGTGGCGCGGG - Intergenic
1076953110 10:133682123-133682145 CGGGCGGGCGACGGTGGCGCGGG - Intergenic
1076954094 10:133685422-133685444 CGGGCGGGCGACGGTGGCGCGGG - Intergenic
1076955078 10:133741774-133741796 CGGGCGGGCGACGGTGGCGCGGG - Intergenic
1076957057 10:133748394-133748416 CGGGCGGGCGACGGTGGCGCGGG - Intergenic
1076959029 10:133755002-133755024 CGGGCGGGCGACGGTGGCGCGGG - Intergenic
1076960018 10:133758312-133758334 CGGGCGGGCGACGGTGGCGCGGG - Intergenic
1076961002 10:133761611-133761633 CGGGCGGGCGACGGTGGCGCGGG - Intergenic
1077101255 11:823599-823621 CGGGCGGGAGAGGGCGGGGTGGG + Intronic
1077185533 11:1233931-1233953 CGGCAGGGTTCAGGTGGGGTGGG - Intronic
1077206291 11:1346393-1346415 GGGGCACGTGCCGCTGGGGTGGG + Intergenic
1077206404 11:1346728-1346750 GGGGCGTGTGCTGTTGGGGTGGG + Intergenic
1077206468 11:1346904-1346926 GGGGCCGGTGCTGCTGGGGTGGG + Intergenic
1077221991 11:1421955-1421977 GGGGCAGGTGGGGGTGGGGTCGG + Intronic
1077378271 11:2215715-2215737 GGGACGGGTGCTGGGGGGGTAGG + Intergenic
1077495844 11:2886144-2886166 GGGGCGGGAGCCGGGGGGGTGGG - Intergenic
1077539725 11:3140834-3140856 TGGGCGGGTAGGGGTGGGGTAGG - Intronic
1077898845 11:6474058-6474080 CGTGCGGGTGCGGTAGGGGTGGG - Intronic
1077923127 11:6655932-6655954 CGGGCGGGCGCCGGGGGGAAGGG - Intergenic
1079237052 11:18698685-18698707 CGGGCGGGAGCCGGGGGGGCGGG - Intronic
1083272001 11:61577351-61577373 CGGGCATGTGCCGATGGGGCAGG + Intronic
1083741257 11:64712788-64712810 CGGGCGAGGGCGCGTGGGGTTGG - Intronic
1083841883 11:65309257-65309279 CGGGGAGGTGGCTGTGGGGTTGG + Intergenic
1083997156 11:66278273-66278295 GGGGCGCGGGCCGGTGGGCTCGG - Exonic
1084165275 11:67372578-67372600 CGGGCGGGAGCGGGAGGGGGCGG - Intronic
1084284089 11:68120731-68120753 GGGGCGTGGGCCGGGGGGGTCGG - Intronic
1084610512 11:70199644-70199666 CGGGAAGGTGCGGGTGGGGTGGG - Intergenic
1087404896 11:97718049-97718071 GGCGCGGGTTCCGGTGGGGGCGG - Intergenic
1089346498 11:117795059-117795081 AGGGCGGGAGCAGATGGGGTTGG - Intronic
1090048650 11:123358491-123358513 GGGGCGGGAGCCGCTGGGGCGGG - Intergenic
1090133561 11:124170937-124170959 CTGCCGGGGGCCGGTGGGGCCGG + Intergenic
1090253801 11:125268948-125268970 CGGGAGGGTGCCATGGGGGTGGG + Intronic
1090710027 11:129375723-129375745 CGGGCGGGCGGGGGCGGGGTGGG + Intergenic
1090809428 11:130223680-130223702 GGGGCGGGTTCCGGGGGAGTGGG + Intergenic
1091498391 12:991551-991573 CGGGTGGGCGCCGGTGGTCTGGG - Intronic
1092216711 12:6688901-6688923 GGGGCGGGTGCCTGTCTGGTGGG - Intronic
1092726513 12:11491526-11491548 CTGGGGGGTGTCGGTGGGGAGGG + Intronic
1093488628 12:19680713-19680735 GGGGCGGGGGGGGGTGGGGTGGG + Intronic
1093896931 12:24584327-24584349 CGGGAGGGTGGGGGTGGGGGTGG - Intergenic
1094201378 12:27797907-27797929 CTGGCGGGTGACGGTGTTGTAGG - Exonic
1096073148 12:48787252-48787274 CGGGCCAGTGCTGGTGGGGGTGG - Intronic
1096220983 12:49828081-49828103 GGGGCGGGAGGGGGTGGGGTGGG + Intronic
1096491640 12:52015790-52015812 CTGGCGAGTTCAGGTGGGGTGGG + Exonic
1098279175 12:68845949-68845971 AGGGCGGGTGGCAGCGGGGTCGG - Exonic
1100505594 12:95217429-95217451 CGGGCGCGAGCCGCCGGGGTCGG + Exonic
1104754713 12:131261905-131261927 TGGGCGGGGGGCGGTGGGGAAGG - Intergenic
1105031483 12:132887405-132887427 CGGGCCGGGGCCCGCGGGGTGGG - Intronic
1105537964 13:21287603-21287625 CGGGCGGGGGCTGGGAGGGTGGG - Intergenic
1106138282 13:26990693-26990715 CGGGCGTGTGAGGGTGTGGTGGG - Intergenic
1108453884 13:50594501-50594523 CAGGCGGGGGCGGGTGGGGGGGG + Intronic
1109301136 13:60591360-60591382 CTGGAGGGCTCCGGTGGGGTGGG - Intergenic
1113874309 13:113584921-113584943 CGGGCGGGAGCCGGGGGTGCGGG + Intronic
1116080487 14:40164251-40164273 CGGGGGGGTGGCGGGGGGGTGGG + Intergenic
1116233600 14:42249509-42249531 CCGGCGGGTGGGGGTGGGGTCGG - Intergenic
1117246577 14:53892305-53892327 TGGGGGGGTGGAGGTGGGGTGGG - Intergenic
1117307263 14:54488886-54488908 AGGGCGGGGGCCGGAGGGCTGGG - Intronic
1117392072 14:55271652-55271674 GGGGCGGGTGGGGGTGGGGGCGG + Intronic
1117684642 14:58240810-58240832 CGGGGGGGTGGGGGTGGGGGGGG - Intronic
1118316153 14:64727498-64727520 GGGGTGGGGGCAGGTGGGGTGGG - Intronic
1119236806 14:73026800-73026822 GGGGCGGGTGCGGCGGGGGTGGG - Intronic
1119281735 14:73414711-73414733 GGGGCGGGTGCGGGGGGGGCGGG + Intronic
1119325657 14:73758594-73758616 CGCGCGGGGGGCGGTGGGATGGG - Intronic
1119539068 14:75427366-75427388 CTGGCGGGGGCCGGTGGGTAGGG + Intergenic
1121007588 14:90500210-90500232 CAGGAGGGTGCTGGTGGGGAAGG + Intergenic
1121645875 14:95516723-95516745 CGGGCGGGTCCCGGCGGGGGCGG - Intronic
1121796463 14:96740390-96740412 GGGGCGGGGGGCGGTGGGGGGGG - Intergenic
1121892043 14:97603429-97603451 CGGGCAGGTCCCTGTAGGGTGGG - Intergenic
1122081049 14:99268279-99268301 TGGGTGGGTGGCGGTGGGGAGGG - Intronic
1122152200 14:99731335-99731357 GGGGAGGGTGCGGGTGGGGGTGG - Intergenic
1122172587 14:99889284-99889306 CTGGTGGGTGGTGGTGGGGTCGG - Intronic
1122396656 14:101437597-101437619 CTGGTGGGCTCCGGTGGGGTGGG + Intergenic
1122632367 14:103112787-103112809 CTGCAGGGTGCCGGTGGGGGTGG + Intergenic
1122741729 14:103875463-103875485 CAGGTGGGTGGGGGTGGGGTGGG + Intergenic
1122798858 14:104219960-104219982 TGGGAGGGTGCACGTGGGGTAGG + Intergenic
1122885846 14:104709944-104709966 CGGGAGGGTGCCTGTTGGATGGG + Intronic
1122905653 14:104800479-104800501 GGGGCGGGGGCCGGAGGGGGCGG - Intergenic
1122997929 14:105275676-105275698 CGAGCTGGTGCCTGTGGGGTCGG - Intronic
1123010374 14:105346887-105346909 CGTGCGGGTGGGGGTGGGGGTGG - Intronic
1123040069 14:105486825-105486847 CGGGCGGGTGCCGGTGGGGTAGG + Intergenic
1123041961 14:105493955-105493977 CGGGGGGGTGGGGGTGGGCTGGG + Intronic
1202855980 14_GL000225v1_random:52565-52587 CGGCCGGGGGCTGGTGGTGTGGG - Intergenic
1202856944 14_GL000225v1_random:57837-57859 CGGCCGGGGGGTGGTGGGGTGGG - Intergenic
1202865659 14_GL000225v1_random:115239-115261 CGGCCGGGGGCTGGTGGTGTGGG + Intergenic
1124120389 15:26883566-26883588 CGGGCGGGGGCGGGCGGGGCCGG + Intronic
1125626857 15:41116025-41116047 CGGGCGGGGTCCGGAGGGGGGGG + Exonic
1127556670 15:60094460-60094482 CGGGCGGGTGTGGGGGGGGGTGG - Intergenic
1128451896 15:67810703-67810725 AGGGAGGGTGCCTGTGGTGTGGG + Intergenic
1129110250 15:73333089-73333111 GGGGCTGGTGCCAGTGGGCTGGG - Intronic
1131118689 15:89809689-89809711 CTGACGTGTGCTGGTGGGGTTGG - Intronic
1131828457 15:96338881-96338903 CGGGCGGGGGGTGGTGGGGGGGG + Exonic
1132055502 15:98648318-98648340 CGCGCGGGAGGCGGTGGGGCGGG + Intergenic
1132182633 15:99770658-99770680 GGGGCGGGGGGCGGGGGGGTTGG - Intergenic
1132483999 16:180902-180924 CGGGAGGGCCCCGGCGGGGTGGG + Intronic
1132757504 16:1493299-1493321 GGAGCGGGGGGCGGTGGGGTGGG - Intergenic
1132826699 16:1908798-1908820 CTGGCAGGTGCCAGTGTGGTGGG + Intergenic
1132867304 16:2099841-2099863 CAGGTGGGTGCCGTAGGGGTCGG - Exonic
1132887492 16:2189068-2189090 AGGGCTGGTGCCGTTGGGGTCGG + Exonic
1133099522 16:3470651-3470673 AGGGCAGGGGCCAGTGGGGTTGG + Intronic
1133131066 16:3676364-3676386 CGGGCGGGGGGCGGGGGGGCGGG + Intronic
1133234717 16:4382497-4382519 CGGGCGGGTGCCGGAGGGCGAGG + Exonic
1133318887 16:4900939-4900961 GGGGCGTGTGCTGGTGTGGTGGG - Intronic
1134050254 16:11132231-11132253 GGGGCGGGGGCGGGGGGGGTGGG - Intronic
1134524471 16:14933274-14933296 CAGGTGGGTGCCGTAGGGGTCGG + Intronic
1134548429 16:15127667-15127689 CAGGTGGGTGCCGTAGGGGTCGG - Intronic
1134712060 16:16331761-16331783 CAGGTGGGTGCCGTAGGGGTCGG + Intergenic
1134719917 16:16375054-16375076 CAGGTGGGTGCCGTAGGGGTCGG + Intergenic
1134795914 16:17036824-17036846 CCGCCGGGTGACGGTGGGGCAGG - Intergenic
1134947509 16:18336831-18336853 CAGGTGGGTGCCGTAGGGGTCGG - Intergenic
1134954769 16:18376933-18376955 CAGGTGGGTGCCGTAGGGGTCGG - Intergenic
1135631015 16:24035606-24035628 GGGGAGGGTGGCGGAGGGGTGGG + Intronic
1136457818 16:30391841-30391863 CGGGGGGGTGGGGGTGGGATAGG + Intronic
1136867413 16:33768929-33768951 TGGGCGAGGGCCTGTGGGGTGGG - Intergenic
1137270289 16:46898431-46898453 TGGGCTGGAGGCGGTGGGGTGGG + Intronic
1137569074 16:49552901-49552923 AGAGCGGGTCCAGGTGGGGTCGG - Intronic
1137600876 16:49755294-49755316 CGGGAGGGTTCTGGTGGGCTCGG - Intronic
1138889840 16:61128832-61128854 CGTGCGGGAGCCGGTGGGGGAGG + Intergenic
1139364843 16:66427068-66427090 GGGGCCGGTGACGGTGGCGTGGG + Intergenic
1139365189 16:66428281-66428303 CGGGCGGGTGCCGGCGTGGGTGG + Intronic
1139840933 16:69879381-69879403 TGGGCGGGGGCCGGTCAGGTTGG - Intronic
1140172599 16:72622472-72622494 TGGGCGGGGGGCGGTGGGGGCGG + Intergenic
1140237427 16:73172071-73172093 CAGGCGGGTGGAGGAGGGGTGGG - Intergenic
1140808008 16:78551647-78551669 GGGGCGGGGGCAGGTGGGGCGGG - Intronic
1141509210 16:84501692-84501714 AGGGCTGGTGCCAGTGAGGTGGG + Intronic
1141644581 16:85360367-85360389 CGGGTGGGGGCAGGTGGGGCAGG + Intergenic
1141959162 16:87392736-87392758 CGGGCGGGGGCCGGTGCGCTCGG + Intronic
1142065349 16:88059235-88059257 AGGGCAGGTGGGGGTGGGGTGGG + Intronic
1142228420 16:88888478-88888500 TGGGGGGGTGCGGGTGGGGTTGG + Intronic
1142637722 17:1268409-1268431 CGGGCGGGGGCGGGCGGGGGCGG - Intergenic
1142818867 17:2448065-2448087 CGGGAGGGAGGCGGGGGGGTGGG + Intronic
1143425323 17:6831610-6831632 CGGGTAGGGGTCGGTGGGGTGGG + Intronic
1143876739 17:9997239-9997261 CGGGCGGGTGGGGGCGGGGGCGG + Intronic
1145902612 17:28498284-28498306 AGGCCGGGTGGAGGTGGGGTGGG - Intronic
1146022581 17:29292796-29292818 GGGGCGGGGGCGGTTGGGGTGGG - Intronic
1146444434 17:32922874-32922896 CGGGAGGGAGGCGGGGGGGTGGG - Intergenic
1146763111 17:35495673-35495695 CGGACTGGTGGGGGTGGGGTGGG - Intronic
1146846300 17:36183657-36183679 TGGGCTGGGGCTGGTGGGGTTGG - Intronic
1147258773 17:39196993-39197015 CAGGCGGGTGTGGGTGGGGCGGG - Intronic
1147264379 17:39225880-39225902 CGGGCTGGGGCCGGCGGGGGAGG - Intergenic
1147617162 17:41836278-41836300 CGGGCGGGGGTTGGTGGGGCCGG + Intronic
1147990024 17:44326833-44326855 CGGGCGGGTGGAGGCGGGGGGGG + Intergenic
1148108563 17:45132217-45132239 CGGGCAAGGGGCGGTGGGGTGGG - Intronic
1149784096 17:59421135-59421157 GGGGTGGGTGGGGGTGGGGTCGG - Intergenic
1149849650 17:60027070-60027092 TGGGCTGGGGCTGGTGGGGTTGG - Intergenic
1149860518 17:60119454-60119476 TGGGCTGGGGCTGGTGGGGTTGG + Intergenic
1150250061 17:63700163-63700185 GGGGCGGGGGCCGGCGGGGGCGG - Intronic
1151802511 17:76386234-76386256 CGCGCGGGAGCTGGTGCGGTCGG + Exonic
1152388408 17:79988892-79988914 CGGGCAGGTGCGGGTTGGGGAGG - Intronic
1152406511 17:80101256-80101278 CGGCCCGGTCCCCGTGGGGTCGG - Intergenic
1152524396 17:80879339-80879361 CAGGCGGGGGCAGGTGGCGTTGG - Intronic
1152611653 17:81317792-81317814 CAGGCGTGTGCGGGTGGGGTGGG + Intronic
1152613219 17:81325821-81325843 CGGGCAGGTGCTGGTGGGCGTGG - Intronic
1152613656 17:81328359-81328381 CGGGCGGGTGAGGGTGGGCTGGG - Intronic
1152834358 17:82519837-82519859 CGCGCGGGCGCCGGTGGCGCGGG - Exonic
1153219390 18:2847973-2847995 CGGGGCGGTGGGGGTGGGGTGGG + Intronic
1154386023 18:13892427-13892449 GGGATGGGTGCCGGTGGGGAGGG - Intronic
1156118953 18:33820227-33820249 CGGGTGGGCGCCGGCTGGGTGGG - Intergenic
1159069360 18:63605961-63605983 CGGGGGGGTGGGGGGGGGGTGGG + Intergenic
1159887059 18:73918921-73918943 GGGGCGGGGGGCGGTGGTGTGGG - Intergenic
1160100677 18:75916837-75916859 CGCGCAGGTGCAGGTGGGGCAGG - Intergenic
1160163836 18:76494372-76494394 CCGCCGGGTGCGGGTGGGGGAGG - Intronic
1160500942 18:79400829-79400851 GGGGCGGGTGGGGGGGGGGTCGG - Intronic
1160824895 19:1074890-1074912 CGGGCGGGGGCGGGCGGGGGCGG + Intronic
1160868497 19:1266582-1266604 CGGGCGGGGCCCCGTGGGGAGGG + Intronic
1160989283 19:1853976-1853998 CGGTGGGGTGGGGGTGGGGTGGG + Exonic
1161077820 19:2294804-2294826 GTGGCGGGTGGAGGTGGGGTTGG + Intronic
1161101742 19:2424943-2424965 GGGGCGGGGGCCGGGGGCGTGGG + Intronic
1161138955 19:2636880-2636902 CAGGTGGGTGCAGGTGGGGATGG - Intronic
1161346306 19:3770415-3770437 AGGACGGGTGGCGATGGGGTGGG + Exonic
1161407903 19:4100768-4100790 GGGGAGGGTGCAGCTGGGGTGGG + Intronic
1161594479 19:5144193-5144215 AGCGCGGGTGTCGGTGGGGGCGG - Intronic
1161723850 19:5917523-5917545 CTGGACGCTGCCGGTGGGGTGGG + Exonic
1161809549 19:6464244-6464266 CAGGGCGGAGCCGGTGGGGTCGG + Intronic
1161977195 19:7613202-7613224 GGGGCGGGGGCGGGTGGGGGCGG + Intronic
1162030819 19:7916569-7916591 CGGATGGGGGCCGGTGGGGACGG + Intronic
1162044015 19:7987105-7987127 CCGGGGGGTGCCGGGGGGGGGGG + Intronic
1162471025 19:10871979-10872001 GGGGCGGGGGCCGGCGGGGAGGG + Intronic
1163123752 19:15233142-15233164 CGGGGAGGGGGCGGTGGGGTGGG + Intronic
1163696870 19:18768623-18768645 CGGACGGGCGCCTGTGGGGGTGG - Exonic
1164120548 19:22261737-22261759 CGAGCGGGTGCGGGCGGGGCGGG + Intergenic
1165390189 19:35534291-35534313 AGGGCGGGGGCCGCAGGGGTAGG + Intronic
1165798949 19:38536126-38536148 ATGGCGGGTGGGGGTGGGGTGGG - Intronic
1165939846 19:39409663-39409685 CGGGCGGGTGCGGTCGGGGACGG + Intergenic
1166343202 19:42150797-42150819 AGGCCGGGTGGGGGTGGGGTGGG + Intronic
1166524964 19:43504905-43504927 CGGGCCGGGGCCGGTGGGGCCGG - Exonic
1166792238 19:45405119-45405141 GAGGCGGGTCCCGGTGGGGAGGG + Intronic
1167146014 19:47681121-47681143 GGGGCGGCGGCCTGTGGGGTGGG - Exonic
1167379336 19:49129515-49129537 CGGGGCGGAGCCGGTTGGGTGGG + Intronic
1167463896 19:49640143-49640165 CGGGCGGGACCCGGGGGGGCGGG + Exonic
1167593907 19:50417717-50417739 CGGGAGGGGGCGGGTGGGCTGGG + Intronic
1167649017 19:50719545-50719567 CGGGCGGGGACCGGGGGGGAGGG + Intergenic
1168257222 19:55173603-55173625 CGGGAGGGTGGCCGTGGGGGCGG - Exonic
1168267505 19:55230730-55230752 CGGGGGGGTGGGGGTGGGGCTGG - Intronic
1168346430 19:55652296-55652318 CGGGCCGGTGCAGGTGGAGACGG - Intronic
925089053 2:1138495-1138517 CAGTCTGGTGCCTGTGGGGTGGG + Intronic
925347851 2:3183226-3183248 CGGGCGGGTGGGTGGGGGGTAGG - Intergenic
925587062 2:5474927-5474949 CTGGCAGGTGCGGGTGGGGCAGG - Intergenic
926095783 2:10080097-10080119 CCGGCGGGTGCCGGTGGCGGCGG - Exonic
927548657 2:23977348-23977370 CGGGGGGGTGGGGGTGGGCTTGG + Intronic
927561575 2:24077200-24077222 CGGGCAGGTGCCGGAGGTGGTGG + Intronic
927858253 2:26540738-26540760 GGGGCGGGGGCAGGTGGGGAAGG + Intronic
928032874 2:27796654-27796676 GGGAGGGGTGCCGGTGGGGAGGG + Intronic
928549712 2:32358024-32358046 CGTGGGGGTGGGGGTGGGGTGGG + Intronic
929454256 2:42055054-42055076 CTGGCGGGTGGGGGTGGGGTAGG - Intronic
929562019 2:42961984-42962006 GGGGAGGGGGCCTGTGGGGTCGG + Intergenic
931356179 2:61538874-61538896 TTGGCGGGAGCCGGTGGGGGCGG - Intergenic
932307463 2:70714284-70714306 TGGGCAGGTGGCGGTAGGGTGGG - Intronic
934525346 2:95048395-95048417 CTGGCGGGTACAGGTGGTGTGGG - Intronic
934655874 2:96116626-96116648 CGGGCGGGAGGCGGGGCGGTGGG + Intergenic
934893363 2:98089502-98089524 CGGGCTAGTGGGGGTGGGGTGGG + Intronic
935745024 2:106182813-106182835 CTGGTGGGTGGGGGTGGGGTGGG + Intronic
937963597 2:127483572-127483594 GGGGCGGGGGGTGGTGGGGTGGG + Intronic
938538410 2:132265299-132265321 GGGGTGGGTTCGGGTGGGGTGGG - Intergenic
938776409 2:134545223-134545245 CCTGGGGGTGCGGGTGGGGTTGG - Intronic
940638996 2:156329061-156329083 CGGGCGGGGGCCAGCCGGGTCGG + Intronic
940830089 2:158457074-158457096 GGGGCGGGGGCCGGTGGGGGAGG + Intronic
942276736 2:174328556-174328578 CGGGCGGGCGGGGGTGGGGGTGG + Intergenic
946395455 2:219441935-219441957 CGGGCGGGAGCCGGCGCGGGTGG - Intronic
947860466 2:233354422-233354444 CGGGCCGGGGGCGGTGGGGGCGG - Intergenic
948142439 2:235683844-235683866 CGGGCGGGGGACGGGGGGCTTGG - Intronic
948420995 2:237859813-237859835 CGGGTGGGAGCGGGTGGGGGCGG + Intronic
1168760613 20:347500-347522 GGCGCGGGTGCCGGTGGGGAAGG + Intronic
1169141375 20:3229066-3229088 AGGGTGGGTGAGGGTGGGGTGGG - Intronic
1169141919 20:3231293-3231315 CCGGCGGGGGCCGGCAGGGTCGG - Intronic
1170567489 20:17615315-17615337 AGGGCAGGTCCCGGTGGGGTCGG + Intronic
1171223232 20:23420559-23420581 CGGGGTGGAGCCGGAGGGGTGGG - Intronic
1172113549 20:32561194-32561216 CAGGGGGCTGCTGGTGGGGTTGG - Intronic
1172599665 20:36175095-36175117 GGGGCGGGCGGCGGTGGGGCAGG + Intronic
1173488476 20:43458552-43458574 GGGGCGGGGGTGGGTGGGGTGGG + Intronic
1173930135 20:46811327-46811349 AGGGCGGGGGCCCGGGGGGTGGG - Intergenic
1174133225 20:48360186-48360208 GGGGCGGGGGCGGGAGGGGTGGG + Intergenic
1175903294 20:62368265-62368287 CGAGGGGGTGGCGGCGGGGTGGG + Intergenic
1176104065 20:63377436-63377458 CGGGGAGGTGGCGGTGCGGTGGG - Intronic
1176230116 20:64028278-64028300 GGGGCGGTTGCCAGTGGGGCTGG + Intronic
1176234908 20:64049613-64049635 AGGGCGGATGGCGGTGGGGACGG + Exonic
1176235400 20:64051324-64051346 CAGGAGGGTGCAGGGGGGGTGGG + Intronic
1179522522 21:41954171-41954193 CGGGCAGGCGCCGGAGGGGCGGG - Intergenic
1180170992 21:46058089-46058111 AGGGCTGGTGCGGGAGGGGTCGG + Intergenic
1180201876 21:46229147-46229169 CTGGTGGGTGCGGGTGGGGGCGG + Intergenic
1180615009 22:17121051-17121073 CGGGCGGCTGCCGGGGGCGGCGG + Exonic
1180871859 22:19150793-19150815 CGTGCGGTTGCCGGTGGTGCTGG - Intergenic
1181463932 22:23100727-23100749 CGGGCGGGAGGCGGTAGGCTTGG + Intronic
1181745362 22:24952381-24952403 CGGGTCGGTGCCGGTGGCGGGGG + Intergenic
1181761652 22:25062800-25062822 GGGGTGGGTGCCGGTTGGGAGGG - Intronic
1182904129 22:33921322-33921344 CGGCCGGGAGCCGCCGGGGTTGG - Intronic
1183577462 22:38700972-38700994 CGGGCGGGGGCCGCTGACGTCGG - Intronic
1183585303 22:38749943-38749965 CTGGCAGGTGGGGGTGGGGTAGG - Intronic
1183697964 22:39433876-39433898 CGGGCAGGGGGCGGTGGGGTGGG - Intronic
1184032814 22:41904903-41904925 CTGGTGGGTGCGGGTGGGGCTGG - Exonic
1184370301 22:44077627-44077649 CAGGTGGGTGCCGGGGAGGTGGG + Intronic
1184804924 22:46788563-46788585 CAGGCGGGTCCCAGTGGGGCTGG - Intronic
1184981465 22:48098995-48099017 GGGGAGGGCCCCGGTGGGGTGGG - Intergenic
1185048089 22:48539045-48539067 GGGGTGGGAGCCTGTGGGGTGGG + Exonic
1185272684 22:49936064-49936086 CGGGCGGGTCCCTATGGGGCTGG - Intergenic
950012400 3:9732425-9732447 GGGGCGGGGGCCGGAGGGATAGG - Intronic
950797370 3:15521015-15521037 GTGGCAGGGGCCGGTGGGGTGGG - Intronic
951225989 3:20122013-20122035 TGGTGGGGTGCCGGTGGGGGCGG + Intronic
951558820 3:23945886-23945908 CGCGCGGGCGCCGGTTGGCTGGG + Intronic
952382587 3:32816849-32816871 CGGGCGCGAGCCGGCGGCGTTGG + Intergenic
954121037 3:48500276-48500298 CAGACGGTTGCCTGTGGGGTGGG + Intronic
954683557 3:52358727-52358749 CGGGCGGCTCACCGTGGGGTAGG - Exonic
954822921 3:53347302-53347324 CGCGCGGGTTACTGTGGGGTGGG - Intronic
955015353 3:55064391-55064413 CAGCCAGGTGCCGGTGAGGTGGG + Intronic
958040352 3:88219705-88219727 TGGGTGGGTGGGGGTGGGGTTGG + Intergenic
958040370 3:88219754-88219776 TGGGTGGGTGGGGGTGGGGTTGG + Intergenic
959849664 3:111071762-111071784 CGGGCGGGTGCCGAGGGGAGGGG + Exonic
961117030 3:124339227-124339249 GGGACGGGTGCAGGTGGGCTGGG + Intronic
962454203 3:135550023-135550045 CTGGGGGGTGGCGGTGGGGTAGG - Intergenic
963503870 3:146161093-146161115 CGGGCGGGAGCCGGCGGGCAAGG + Exonic
964358410 3:155870798-155870820 CGGGAGGGTGCCGGAAGGGTCGG - Exonic
967859020 3:194137892-194137914 CCGCCGGGTCCCGGTGGGGGCGG - Exonic
968045909 3:195623879-195623901 GGGGCGGGTGGGGGTGGGGTTGG + Intergenic
968308746 3:197666208-197666230 GGGGCCGGTGGGGGTGGGGTTGG - Intergenic
968341603 3:197960292-197960314 CGGGCCGGAGCCGGTGGCGCTGG + Exonic
968523026 4:1042868-1042890 GGGGTGTGTGTCGGTGGGGTGGG - Intergenic
968901314 4:3433293-3433315 AGGGCGGGAGCCCGTGGGCTTGG - Intronic
969249179 4:5955873-5955895 CAGGCGGGTGCTGGCAGGGTTGG + Intronic
972842527 4:42948600-42948622 CGGCAGGGTGCGGGTGGGGGCGG - Intronic
982584780 4:157222458-157222480 CGGCCGGGTGGCGTGGGGGTGGG + Intronic
983460834 4:168024037-168024059 TGGGAGGGAGCTGGTGGGGTGGG - Intergenic
984272122 4:177559729-177559751 GGGGCGGGTGGCGGGGGGGACGG + Intergenic
985452618 4:190069695-190069717 CGGGCGGGCGACGGTGGCGCGGG - Intergenic
985453605 4:190072992-190073014 CGGGCGGGCGACGGTGGCGCGGG - Intergenic
985454595 4:190076285-190076307 CGGGCGGGCGACGGTGGCGCGGG - Intergenic
985455583 4:190079578-190079600 CGGGCGGGCGACGGTGGCGCGGG - Intergenic
985456567 4:190082872-190082894 CGGGCGGGCGACGGTGGCGCGGG - Intergenic
985457555 4:190086172-190086194 CGGGCGGGCGACGGTGGCGCGGG - Intergenic
985458542 4:190089465-190089487 CGGGCGGGCGACGGTGGCGCGGG - Intergenic
985459531 4:190092765-190092787 CGGGCGGGCGACGGTGGCGCGGG - Intergenic
985463782 4:190175534-190175556 CGGGCGGGCGACGGTGGCGCGGG - Intronic
985541213 5:488577-488599 CTGGCTGGCGCCGGTGGCGTGGG + Intronic
985588628 5:753523-753545 CTGGCGGGTCCTGGTGGGGAAGG - Intronic
985603297 5:845962-845984 CTGGCGGGTCCTGGTGGGGAAGG - Intronic
985883706 5:2659682-2659704 CGGCGGGGTGGGGGTGGGGTGGG - Intergenic
987523082 5:19012602-19012624 TGGGTGGGTGGGGGTGGGGTGGG - Intergenic
990414769 5:55575583-55575605 CGGGGGGGGGGGGGTGGGGTGGG - Intergenic
992105729 5:73448052-73448074 GGGGCAGGAGCCGGTGGGGGCGG - Exonic
993168432 5:84384906-84384928 CGGGCGGGCGCCGGGGGAGTGGG - Intergenic
995065703 5:107859546-107859568 TGGGGGGGTGGGGGTGGGGTGGG - Exonic
995787115 5:115841931-115841953 CGGGAGGGGGCGGGTGGGGAAGG + Exonic
997201410 5:132011981-132012003 GGGGTGGGTGGCGGCGGGGTGGG - Intronic
997375856 5:133396927-133396949 CGGGCGGTTGCAGGTGGATTTGG - Intronic
998402028 5:141853167-141853189 CGGGTGGGTGGGGGTGGGGACGG - Exonic
999150190 5:149421607-149421629 CGGAAGGGTGGAGGTGGGGTGGG - Intergenic
999300346 5:150486522-150486544 CGGGCGGGCGCCGGGCGGGCGGG + Intronic
999989137 5:157033573-157033595 GGGGCGGGGGCGGGTGGGGGTGG + Intronic
1001159591 5:169301168-169301190 CGGGGGGGGGCCGGAGGGGTGGG - Intergenic
1001731586 5:173964447-173964469 AGGGTGGGTGAGGGTGGGGTGGG + Intergenic
1001731595 5:173964469-173964491 GGTGAGGGTGACGGTGGGGTGGG + Intergenic
1001992812 5:176132540-176132562 GAGTCGGGTGCTGGTGGGGTGGG + Intergenic
1002033567 5:176448359-176448381 CCGGCGGGTGACGGTGCGGACGG + Exonic
1002339929 5:178509177-178509199 AGGTCCGATGCCGGTGGGGTGGG - Intronic
1002449534 5:179310923-179310945 CAGGCAGGGGCAGGTGGGGTTGG - Intronic
1004228884 6:13813877-13813899 CGGGCAGATGCCGGTGGCCTTGG + Intronic
1005725068 6:28639999-28640021 CTGCCCGGGGCCGGTGGGGTCGG + Intergenic
1006502055 6:34465652-34465674 CGTGCGGGTGCCTGTGTGGTGGG - Intergenic
1007521457 6:42453705-42453727 CGCCCGGGTGGGGGTGGGGTGGG - Intergenic
1007600123 6:43076235-43076257 CGTGCGGGGGCCGGAGGGGAGGG + Intergenic
1007637538 6:43308248-43308270 GGGGCTGGTGCCTGGGGGGTGGG + Intronic
1007682613 6:43644974-43644996 TGGGCGGTAGGCGGTGGGGTGGG + Intergenic
1010597174 6:77778136-77778158 GGGGCGGGGGGTGGTGGGGTGGG + Intronic
1011127168 6:84019659-84019681 CGGGGGCGAGGCGGTGGGGTTGG + Intergenic
1011603651 6:89081522-89081544 CGGGCGGGTGGGGGCGGGGTGGG + Intronic
1014116843 6:117675868-117675890 CGCGCGGGTGCCGGTGGTGACGG - Exonic
1015935572 6:138403956-138403978 CGGGCAGGGGCCGCGGGGGTCGG + Intronic
1017041227 6:150310093-150310115 GGGGCGGGTGGAGGTGGGGTTGG - Intergenic
1019321377 7:416967-416989 CTGGGTGGTGCCGGGGGGGTGGG + Intergenic
1019343046 7:517527-517549 GGGGCGCGTGCCGGCGGGGTCGG - Intronic
1019354675 7:572352-572374 CGGGCGTGACCCCGTGGGGTTGG + Intronic
1019415879 7:926342-926364 GGGGCGGGGGGCGCTGGGGTGGG - Intronic
1019504560 7:1384254-1384276 CGGGCGGGTCCGGCTGGGGCAGG + Intergenic
1019504589 7:1384329-1384351 CGGGCGGGTCCGGCTGGGGCAGG + Intergenic
1019660474 7:2221152-2221174 AGGGCGGTGCCCGGTGGGGTGGG - Intronic
1022747534 7:33188110-33188132 GTGGCGGGTGGGGGTGGGGTAGG + Intronic
1023000424 7:35801779-35801801 CGGGCGGGCGGCGGCGGGGAGGG + Intronic
1023677979 7:42650858-42650880 TGGGCTGGGGCCAGTGGGGTAGG - Intergenic
1025604626 7:63030424-63030446 CGGGCGGGGGGCGGTGTGGTCGG + Intergenic
1026458189 7:70591155-70591177 GGGGTGGGGGCAGGTGGGGTGGG - Intronic
1026787092 7:73308619-73308641 CGGACGGGCCCGGGTGGGGTCGG - Intronic
1026968102 7:74453252-74453274 CGGGCGGGGGGCGGGGGGGCTGG + Intergenic
1029487536 7:100852692-100852714 CGCGCGCGTGCTGGTGGGGGTGG + Intronic
1031421164 7:121553153-121553175 TTGGCGGGGGCGGGTGGGGTGGG - Intergenic
1032735837 7:134692072-134692094 GGGGCGGGAGGCGGTGGGGTGGG + Intergenic
1033658425 7:143388345-143388367 TGGGGGTGTCCCGGTGGGGTGGG - Intronic
1034469713 7:151248735-151248757 CGGGCGGGCGGCGGCGGCGTGGG - Exonic
1035052141 7:156005126-156005148 CAAGTGGGTGCCGGTGAGGTAGG - Intergenic
1037306063 8:17505078-17505100 CGGGTGGGCGGCGGGGGGGTGGG - Intronic
1040069681 8:43179535-43179557 CGGGAGGGAGGCGGTGGGGGGGG - Intronic
1040069928 8:43180106-43180128 CGGGAGGGAGGCGGTGGGGGGGG - Intronic
1044446048 8:92277266-92277288 CGGGGGGGTGCGGATGAGGTGGG + Intergenic
1045327281 8:101126649-101126671 CGGGCGGGGGCGGCTGGGGGCGG - Intergenic
1045564442 8:103299029-103299051 CGGGCGGGTGCCGGGGGAAGCGG + Intronic
1046108170 8:109691411-109691433 GGGCCGGGTGCCGGTGCGGACGG + Exonic
1047300099 8:123606549-123606571 GGTGCGGGGGCCGGTGGGGAAGG + Intergenic
1047767419 8:128001121-128001143 TGGGCGGTAGGCGGTGGGGTGGG - Intergenic
1047987284 8:130248210-130248232 GTGGCGGGTGCCGGGGGGGTTGG + Intronic
1049290065 8:141797151-141797173 GGTGGGGGTGCGGGTGGGGTTGG + Intergenic
1049746964 8:144267094-144267116 CGGGCGGGAGGCGGCGGGGGCGG - Exonic
1049796781 8:144500620-144500642 CGGGCGGGAGCAGGTGGGAGGGG + Intronic
1051835751 9:21335467-21335489 CGGGAGGGTGGGGGTGGGGAAGG + Intergenic
1052046845 9:23803731-23803753 TGGGGGGTTGCGGGTGGGGTGGG + Intronic
1053691037 9:40587698-40587720 CGGGCGGCTGCAGGCAGGGTTGG + Intergenic
1054273768 9:63049793-63049815 CGGGCGGCTGCAGGCAGGGTTGG - Intergenic
1054302297 9:63388669-63388691 CGGGCGGCTGCAGGCAGGGTTGG + Intergenic
1054401072 9:64715175-64715197 CGGGCGGCTGCAGGCAGGGTTGG + Intergenic
1054434677 9:65199489-65199511 CGGGCGGCTGCAGGCAGGGTTGG + Intergenic
1054489439 9:65762643-65762665 CGGGCGGGGGCCGCGGCGGTGGG - Intergenic
1054495712 9:65822192-65822214 CGGGCGGCTGCAGGCAGGGTTGG - Intergenic
1055397886 9:75892588-75892610 CTGGCTGGTGCCGGCGGAGTGGG + Intronic
1056758460 9:89397642-89397664 CGGGGGTGTGCAGGTGGGTTGGG - Intronic
1056771531 9:89481220-89481242 TGAGCAGGTGGCGGTGGGGTGGG + Intronic
1057186334 9:93059195-93059217 CGGGCGGGTGGCGCGGGGGCGGG + Intronic
1057229196 9:93308602-93308624 GGGGCGGGTGCTCCTGGGGTGGG + Intronic
1057245597 9:93451865-93451887 CGGGCGGGGGGCGGCGGGGCCGG - Exonic
1058866662 9:109167218-109167240 CGGGCGCGTGCTGGTGGCCTCGG - Exonic
1060525152 9:124316224-124316246 AGTGCGGGGGCTGGTGGGGTCGG + Intronic
1061248418 9:129413380-129413402 CGGGCGGGGGCCGGGGCGGGGGG - Intergenic
1061537534 9:131259168-131259190 CGGGCGGGTAGCTGTGGGTTTGG + Exonic
1061582302 9:131545634-131545656 GGGGCAGGTGCCGGAGGGGCAGG + Intergenic
1061582362 9:131545824-131545846 GGGGCAGGTGCTGGTGGGGCGGG + Intergenic
1061675323 9:132212314-132212336 CGGGCGGGTGCTGGGAGGCTTGG - Intronic
1061777177 9:132973304-132973326 CCGGCAGGTGCAGGTGGGCTGGG - Intronic
1062137641 9:134938142-134938164 CAGGCTGGGGTCGGTGGGGTGGG + Intergenic
1062378894 9:136277318-136277340 TGGGTGGGTGCTGATGGGGTGGG + Intergenic
1062379425 9:136280136-136280158 AGCGCATGTGCCGGTGGGGTGGG - Intergenic
1062423956 9:136497569-136497591 AGGGCGGGGGCCGGTGAGGGGGG + Intronic
1062436186 9:136547555-136547577 CTGGTGGGTGGGGGTGGGGTGGG + Intergenic
1062646503 9:137550968-137550990 CGTGGGGGTGCCGCTGGGGAGGG + Intergenic
1062646526 9:137551021-137551043 CGTGGGGGTGCCGCTGGGGAGGG + Intergenic
1202780005 9_KI270717v1_random:24920-24942 GCGGCGGGTGGCGGGGGGGTAGG + Intergenic
1203771127 EBV:50610-50632 AGGGCGGGTGCCTGGGGGATGGG + Intergenic
1203738679 Un_GL000216v2:160919-160941 CGGCCGGGGGCTGGTGGTGTGGG - Intergenic
1187375540 X:18749749-18749771 CGGGGGGGTGGGGGTGGGGGTGG - Intronic
1188242620 X:27809441-27809463 GGGGCGGGGGCGGGCGGGGTTGG - Intronic
1189974075 X:46445099-46445121 CGGGCGGGTGGAGGTTGGGGAGG + Intergenic
1190042530 X:47082781-47082803 GGGGCGGGTGGTGGTGGGGGCGG - Intronic
1190099708 X:47513264-47513286 CGCGCGGGTGCCGGTGGTGACGG + Intergenic
1197713184 X:129686920-129686942 CAGGCTGGTGCCAGTGGGGATGG - Intergenic
1198282535 X:135155902-135155924 GGTGGGGGTGCCGGGGGGGTGGG + Intergenic
1198288424 X:135216620-135216642 GGTGGGGGTGCCGGGGGGGTGGG - Intergenic
1198370582 X:135985460-135985482 CGGGCGGCCGCCGGTGAGGTAGG + Exonic
1199699432 X:150364849-150364871 CGGGCCGGGGCCGCTGGGGGCGG - Intronic
1200068808 X:153517893-153517915 CGCGCGGGCGCCGCCGGGGTGGG + Intronic
1200080852 X:153575638-153575660 GGGGCTGGGGCCGGGGGGGTTGG + Intronic
1200210028 X:154342970-154342992 CGGCCGGCTCCCGGGGGGGTGGG - Intergenic
1200220824 X:154389122-154389144 CGGCCGGCTCCCGGGGGGGTGGG + Intergenic
1201177911 Y:11321296-11321318 CGGCCGGGGGCTGGTGGGGTGGG - Intergenic
1202119798 Y:21510413-21510435 TTGACGGGTGCCGGGGGGGTGGG - Intergenic
1202122249 Y:21533954-21533976 TTGACGGGTGCCGGGGGGGTGGG - Intronic
1202156756 Y:21895429-21895451 TTGACGGGTGCCGGGGGGGTGGG + Intronic
1202159204 Y:21918970-21918992 TTGACGGGTGCCGGGGGGGTGGG + Intergenic
1202185653 Y:22183885-22183907 TTGACGGGTGCCGGGGGGGTGGG + Intergenic
1202205707 Y:22402511-22402533 TTGACGGGTGCCGGGGGGGTGGG - Intronic