ID: 1123042148

View in Genome Browser
Species Human (GRCh38)
Location 14:105494683-105494705
Sequence CTAGGTCAACCCTAACACTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 67
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 64}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123042148_1123042153 -2 Left 1123042148 14:105494683-105494705 CCCAAGTGTTAGGGTTGACCTAG 0: 1
1: 0
2: 0
3: 2
4: 64
Right 1123042153 14:105494704-105494726 AGCCCCAGGCATCTTCCCCAGGG 0: 1
1: 0
2: 4
3: 34
4: 312
1123042148_1123042152 -3 Left 1123042148 14:105494683-105494705 CCCAAGTGTTAGGGTTGACCTAG 0: 1
1: 0
2: 0
3: 2
4: 64
Right 1123042152 14:105494703-105494725 TAGCCCCAGGCATCTTCCCCAGG 0: 1
1: 0
2: 0
3: 25
4: 208
1123042148_1123042162 27 Left 1123042148 14:105494683-105494705 CCCAAGTGTTAGGGTTGACCTAG 0: 1
1: 0
2: 0
3: 2
4: 64
Right 1123042162 14:105494733-105494755 GCTTCCTCGCACCCTGCTGCTGG 0: 1
1: 0
2: 1
3: 21
4: 184
1123042148_1123042157 2 Left 1123042148 14:105494683-105494705 CCCAAGTGTTAGGGTTGACCTAG 0: 1
1: 0
2: 0
3: 2
4: 64
Right 1123042157 14:105494708-105494730 CCAGGCATCTTCCCCAGGGATGG 0: 1
1: 0
2: 5
3: 31
4: 295

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123042148 Original CRISPR CTAGGTCAACCCTAACACTT GGG (reversed) Intronic
904472297 1:30743394-30743416 CTAGGGCCACCCCAACACTCAGG - Intronic
923808958 1:237291147-237291169 CTAGGCCAACTCTTGCACTTGGG + Intronic
1064247224 10:13678555-13678577 ATAGGTCAACCCTCAAACTAGGG + Intronic
1065105427 10:22379008-22379030 TTAGTTTAACCCTAACACATGGG - Intronic
1068397626 10:56484824-56484846 CTTGCTCATCCCTCACACTTGGG + Intergenic
1071368061 10:84921587-84921609 CTAGTTCAAAAGTAACACTTGGG + Intergenic
1071783802 10:88877396-88877418 CCAGGTCACCACTTACACTTTGG + Intergenic
1080856649 11:36117568-36117590 CTAGGACAAACCTAAAACATCGG + Intronic
1087400601 11:97661296-97661318 TTATGTCAATCCTAGCACTTTGG + Intergenic
1087728402 11:101750443-101750465 TTAGGCCATCCCTAACACATGGG + Intronic
1092619688 12:10250639-10250661 CTAGGTCAAGCAGAAAACTTTGG - Intergenic
1095311257 12:40699855-40699877 CTGGGCCAACCATAACACATGGG - Intronic
1096690336 12:53316817-53316839 GTGGCTCAACCCTAGCACTTTGG + Intronic
1107103800 13:36622523-36622545 CCAGCTCATCCCTTACACTTGGG - Intergenic
1110342571 13:74409879-74409901 CTAGTCCAACCCCATCACTTTGG - Intergenic
1117358213 14:54946746-54946768 CCTGGCCAAGCCTAACACTTTGG - Intronic
1117747254 14:58882400-58882422 GTAGGGCCAACCTAACACTTGGG + Intergenic
1120129538 14:80788741-80788763 CTCGGTCAACCCTACAATTTAGG + Intronic
1123042148 14:105494683-105494705 CTAGGTCAACCCTAACACTTGGG - Intronic
1133574394 16:7074182-7074204 CTACTTCAATCCTAACATTTGGG - Intronic
1139500820 16:67363357-67363379 CTGGCTCAACCCTAACAGATAGG + Intronic
1139955543 16:70691384-70691406 CCAGGTTGACCCTAACACTATGG + Intronic
1141558739 16:84853131-84853153 CCAGCTCAACCCTAACACTCAGG - Intronic
1145912010 17:28548384-28548406 CGAGGTCAGCCCTACCCCTTCGG - Intronic
1159247260 18:65823553-65823575 CTAGTTTAACCCTGACATTTTGG + Intronic
1159607538 18:70490595-70490617 CTGAGTTAAGCCTAACACTTCGG - Intergenic
1167217822 19:48176600-48176622 CACGGTCAACCCTCACACTGAGG - Intronic
1168503437 19:56912910-56912932 CTACTTTAACCCCAACACTTTGG - Intergenic
926399979 2:12487305-12487327 CTCGCTCAACCCCAGCACTTTGG - Intergenic
926634247 2:15163584-15163606 CAAAGTGAATCCTAACACTTTGG + Intergenic
933690998 2:85179483-85179505 CTAGGTCATCTCTCAGACTTGGG + Intronic
939298369 2:140300372-140300394 CTAGGTGCACCCTAAGACGTTGG + Intronic
941872529 2:170400666-170400688 CTGGGTGAATCCCAACACTTTGG - Intronic
947879841 2:233498091-233498113 CTAAGGCTACCCTAACAGTTTGG + Intronic
1178445555 21:32638324-32638346 ATGAGTGAACCCTAACACTTTGG - Intronic
950824226 3:15799760-15799782 CTAAGTCAACCTCCACACTTAGG + Intronic
951308951 3:21100192-21100214 TTAGGTCAAGCCTAACTCATAGG + Intergenic
952087871 3:29848465-29848487 CTAGGGCAACTATAAAACTTGGG + Intronic
954992360 3:54852361-54852383 CTAGGTGAACCTGAGCACTTAGG + Intronic
956781283 3:72605315-72605337 CTAAGTCAACTCTCAGACTTGGG - Intergenic
960937223 3:122911622-122911644 CTAGGTCAACGCTCAGACGTAGG + Intronic
965395759 3:168159077-168159099 CTTGGGCAACACTAATACTTAGG + Intergenic
976233721 4:82872963-82872985 GTAGCTCAATCCTAACACTTTGG - Intronic
980364270 4:131778766-131778788 CTAGGTCAACCTTACCCTTTGGG + Intergenic
985877754 5:2613208-2613230 CTAAGTCACCCCTACCACCTTGG + Intergenic
986718243 5:10539403-10539425 CCAGGTCAACCCAAAGACATGGG - Intergenic
996772015 5:127095891-127095913 CTAGGACAACCCAAAGACTCTGG - Intergenic
998727034 5:145029245-145029267 CTTGGTCACCCTTAACACCTTGG + Intergenic
1001269588 5:170301379-170301401 GTGGGTCAATCCCAACACTTTGG + Intergenic
1002051682 5:176575080-176575102 CCAGGTCATCCCTAGCACTGGGG + Exonic
1002995849 6:2283865-2283887 CTAGATCAATCCTGACTCTTCGG - Intergenic
1014892538 6:126860494-126860516 GTAGGTCAACCCTAAGAATAAGG + Intergenic
1017710313 6:157161786-157161808 CTAGGCTAACACTAAAACTTGGG - Intronic
1019528279 7:1490928-1490950 AGAGGTCAACCCTCAAACTTGGG + Intronic
1033236478 7:139641733-139641755 CTTGCTCACCCCAAACACTTTGG + Intronic
1034848623 7:154472035-154472057 CTAGGTCAATCCCCACACCTCGG - Intronic
1037880386 8:22570814-22570836 CTCATTCAACCCTAACACCTTGG - Intronic
1040391098 8:46951282-46951304 CCAGCTCAGCCCTAACTCTTAGG + Intergenic
1048005165 8:130413301-130413323 CGAGCTCATTCCTAACACTTAGG + Intronic
1050170470 9:2810575-2810597 CTAGGACAACCATCATACTTGGG + Intronic
1050400121 9:5244383-5244405 CTGGGGCAAGCCTAACACCTGGG - Intergenic
1053628625 9:39904657-39904679 CTAGGTCAACCTTACCCTTTGGG + Intergenic
1053777441 9:41561687-41561709 CTAGGTCAACCTTACCCTTTGGG - Intergenic
1054215262 9:62346045-62346067 CTAGGTCAACCTTACCCTTTGGG - Intergenic
1054672219 9:67809304-67809326 CTAGGTCAACCTTACCCTTTGGG + Intergenic
1057145979 9:92759914-92759936 CTAGGTCTCCCCTGTCACTTAGG - Intronic
1190886042 X:54531466-54531488 ATAGATCAGCCCTAATACTTGGG - Intronic