ID: 1123042693

View in Genome Browser
Species Human (GRCh38)
Location 14:105496854-105496876
Sequence AGGGGGTCCCTGAAGTTACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 122}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123042685_1123042693 9 Left 1123042685 14:105496822-105496844 CCTGGGTCACTAGGCAGACTCCT 0: 1
1: 0
2: 0
3: 8
4: 145
Right 1123042693 14:105496854-105496876 AGGGGGTCCCTGAAGTTACAGGG 0: 1
1: 0
2: 1
3: 18
4: 122
1123042684_1123042693 12 Left 1123042684 14:105496819-105496841 CCACCTGGGTCACTAGGCAGACT 0: 1
1: 0
2: 1
3: 8
4: 107
Right 1123042693 14:105496854-105496876 AGGGGGTCCCTGAAGTTACAGGG 0: 1
1: 0
2: 1
3: 18
4: 122
1123042682_1123042693 21 Left 1123042682 14:105496810-105496832 CCTTCTCTGCCACCTGGGTCACT 0: 1
1: 0
2: 6
3: 85
4: 1017
Right 1123042693 14:105496854-105496876 AGGGGGTCCCTGAAGTTACAGGG 0: 1
1: 0
2: 1
3: 18
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123042693 Original CRISPR AGGGGGTCCCTGAAGTTACA GGG Intronic
901065964 1:6494813-6494835 AGGGCGTCCCAGTAGTGACAGGG + Intronic
902610131 1:17592355-17592377 ATGGGCTCCCTGAAGGTACCTGG + Intronic
903769324 1:25754028-25754050 AGGAGGTCCCTGAAGCTGCTAGG + Intronic
904928562 1:34067702-34067724 AGGGGGTCCCTGATTTTAAAAGG - Intronic
906945185 1:50289065-50289087 GGAGGGTCCCTGAAGCTGCAAGG - Intergenic
907388754 1:54142690-54142712 AGGGCCTTCCTAAAGTTACATGG - Intronic
907691881 1:56676960-56676982 ATGAGGTCCCTGAAATTGCATGG + Intronic
910879134 1:91906510-91906532 AGGGTGTCCCTGAGGTTTCTGGG + Intergenic
914311725 1:146472530-146472552 AGCGGGGCCCTAAAGGTACATGG - Intergenic
916409453 1:164531115-164531137 TGGCCGTTCCTGAAGTTACAAGG - Intergenic
917495389 1:175535821-175535843 AGAGGGTCCATGAACTTATACGG + Intronic
918448976 1:184641130-184641152 AGGTGGTCCCTGAAGTTCCCAGG + Intergenic
921182182 1:212640095-212640117 AGGTGGTCCCTGAAGCTTGAGGG - Intergenic
921599134 1:217088926-217088948 AGGGAGTCGCTGAAGTTGCACGG - Intronic
1065289931 10:24219762-24219784 AGGGGGGCCCCGAAGTTCCAAGG + Exonic
1065615179 10:27513768-27513790 AGGGGGGCCTTGCAGTTTCATGG - Intronic
1067942684 10:50669647-50669669 TGGGGGTCAGTGAAGTGACACGG - Intergenic
1070863927 10:79694610-79694632 TGGGGGTCAGTGAAGTGACACGG - Intergenic
1071293459 10:84203178-84203200 AGGGGGTCCCTAAAATCACAAGG - Intronic
1071630825 10:87216836-87216858 CGGGGGTCAGTGAAGTGACATGG - Intergenic
1074408266 10:113200122-113200144 ATGGTGTCCCACAAGTTACATGG - Intergenic
1076332362 10:129679456-129679478 TGCGGGTCCCTGGAGTCACATGG - Intronic
1084892942 11:72245285-72245307 AGGCGGGCCCTGAAGGTGCAAGG - Intronic
1088838605 11:113602993-113603015 AGGGGGTGCCAGAAGATACATGG + Intergenic
1091901256 12:4145811-4145833 TGGGGGTCCCTAGAGCTACAGGG + Intergenic
1092860341 12:12714753-12714775 ATGGAGTCCCTGAAGGAACAGGG - Intergenic
1095573063 12:43704494-43704516 AGGGGGTCTATGAAGTTTCTTGG - Intergenic
1096807974 12:54151808-54151830 CTGGGGACCCTGAACTTACAGGG + Intergenic
1098351456 12:69566084-69566106 AGTGGTTCCCTGAGATTACAAGG - Intronic
1099250888 12:80252331-80252353 AGTTGGTCCTTGAAGTGACAAGG + Intronic
1101750888 12:107581469-107581491 AGCAGGTCCCTGGAGTTGCAGGG + Intronic
1107864274 13:44688176-44688198 AGGAGGTCCCTGAACTTAAATGG - Intergenic
1108785131 13:53891324-53891346 AGGGTGTCCTTCAAGTTAGATGG - Intergenic
1111405498 13:87799089-87799111 AGAGGGTCCCAGAACTTTCAAGG - Intergenic
1113044112 13:106135920-106135942 AGTTGGTCCCTGACTTTACATGG - Intergenic
1119078744 14:71672127-71672149 ACGGCTTCCCTGAAGTTACAAGG - Intronic
1119414411 14:74460011-74460033 TGGGGGTCCCTGGAGGTCCAGGG - Intergenic
1121151435 14:91638729-91638751 AGGTTGTCCCTGAAGAAACATGG - Intronic
1122663925 14:103316081-103316103 AGGGGGCCCCTGAAGTACCCAGG - Intergenic
1122857934 14:104568868-104568890 AGGGAGGCCCTGAAGGTGCAGGG - Intronic
1123042693 14:105496854-105496876 AGGGGGTCCCTGAAGTTACAGGG + Intronic
1123089511 14:105736163-105736185 CGGGGGTCCATGTAGTGACAGGG + Intergenic
1123990957 15:25683006-25683028 AGGGGATCACTGAAGCTAGAGGG - Intronic
1124022713 15:25938976-25938998 AGGGGGTCCCTCAGCTTCCATGG + Intergenic
1124057979 15:26260326-26260348 AGTGGGTCCCAGATGTTGCATGG - Intergenic
1129135043 15:73541211-73541233 AGGGGGTCCATGAACTTCCATGG + Intronic
1129191927 15:73942322-73942344 AGTGTGTCCCTGAAGGTTCATGG - Intronic
1131020351 15:89092641-89092663 AAGTGGTCCCTGAACTTCCAAGG + Intronic
1132116986 15:99144630-99144652 AGAGGGTCATTTAAGTTACAAGG + Intronic
1132745606 16:1434945-1434967 AGGGTTTCCCTGAAGATAAATGG - Intronic
1133656638 16:7871256-7871278 ATGGTGTCCTGGAAGTTACAGGG + Intergenic
1135288096 16:21211343-21211365 TGGAGTTCCCTGAAGTCACAAGG + Exonic
1141642677 16:85350426-85350448 CTAGGGTCCCTGAAGTCACAGGG - Intergenic
1150312115 17:64137253-64137275 AGGGCTTCCATGAAGTTACTCGG - Intergenic
1150521605 17:65873067-65873089 AGCTGGTGCCTGAAGTTGCATGG - Intronic
1150559295 17:66281017-66281039 CGGGTGACCCTGAGGTTACAGGG + Intergenic
1154405498 18:14086376-14086398 AGGGGGATCCTCAAGTTCCACGG - Intronic
1156609539 18:38710147-38710169 AGGGGATCCCTGGAACTACAAGG - Intergenic
1161582536 19:5088622-5088644 AGGGGGCCCCTGAGGCTGCAGGG + Intronic
1162184835 19:8896832-8896854 ATGGAGTCCCTGAGGTTCCAAGG + Exonic
1162186412 19:8908620-8908642 ATGGAGTCCCTGAGGTTCCAAGG + Exonic
1165498328 19:36167645-36167667 AGGGGGTCGCTGAATTTTGATGG + Intergenic
1166646806 19:44538274-44538296 AGGTGGTCTGTGAAGCTACAAGG + Intergenic
1166980289 19:46627926-46627948 AGGGGGACCCTGAAGCAGCAGGG + Intergenic
1168518644 19:57030773-57030795 ATGGGGTCCCTGCATTTACCAGG - Intergenic
927620268 2:24648615-24648637 AGGGTGACCCTGAAGTTAACCGG + Intronic
929331473 2:40686566-40686588 AGAGGATCTGTGAAGTTACATGG + Intergenic
929740878 2:44598251-44598273 AGGGGGTCCATGAACTTGCAAGG - Intronic
932658071 2:73627384-73627406 AGGGAGTCACTGAACTAACAAGG + Intergenic
932664698 2:73687421-73687443 AGGGAGTCACTGAACTAACAAGG + Intergenic
935788713 2:106571457-106571479 AGGGGGACACTGAAGTGACCAGG + Intergenic
937979821 2:127608408-127608430 TGGGGGTCCCTGGAGTTTGAAGG + Intronic
939291352 2:140199455-140199477 TGGGGGTCACTGCAGTTATATGG - Intergenic
940733128 2:157417529-157417551 AGGAGGTGGCTGAATTTACAAGG + Intronic
943329390 2:186540887-186540909 GGGGGTTCCCTAAAGTTAAAAGG - Intergenic
946709182 2:222488660-222488682 AGGGGAGCCCTGAACTCACATGG - Intronic
948737886 2:240021663-240021685 AGGGGGCTCCTGTGGTTACAGGG - Intronic
948961036 2:241337315-241337337 AGGGGGTCCCTGACTTCAAAGGG - Intronic
1171104633 20:22420905-22420927 AGGGTGGCCCTGAGTTTACAAGG - Intergenic
1171122026 20:22576627-22576649 AGGAGGTACCTGAAGTTACCTGG - Intergenic
1172468257 20:35172851-35172873 AGGGGGAGACTGAAGTTACGGGG - Intronic
1176016256 20:62934824-62934846 AGGCGCTCCCTGAAGCCACAGGG - Intronic
1177059396 21:16352324-16352346 AGTGGGTGCCTGAAGGTAAAAGG - Intergenic
1178502625 21:33138359-33138381 ATGGGGTCCCTGAACTTACATGG + Intergenic
1182113612 22:27742250-27742272 TGGTGGTCCCTGAGGTGACAGGG - Intergenic
1184732038 22:46376011-46376033 AGTGGGTTCCTGATGTTACAGGG + Intronic
1185091797 22:48779671-48779693 AGTGGGTCCCTGCAGCTACTCGG - Intronic
950191209 3:10977407-10977429 AGGAGGTCCGTGAACTTGCATGG + Intergenic
951165206 3:19477470-19477492 AAGGGGACCCTGAAGTTGAAGGG + Intronic
953679349 3:45028020-45028042 AAGGGGCCCCTGGAGTTCCAGGG + Intronic
954602605 3:51881309-51881331 AGATGGAGCCTGAAGTTACAGGG + Intergenic
960650235 3:119939913-119939935 AGAGAGTCACTGAAGTCACAAGG + Intronic
960808722 3:121608639-121608661 AGGGGGTCCTAGAAGCTAAAGGG - Intronic
961619205 3:128210223-128210245 AGGGGGTCCCAGAAATGACTTGG + Intronic
962967308 3:140366814-140366836 AGCTGGTCCCTGACGCTACAAGG - Intronic
965796709 3:172448070-172448092 AGGAGGTCGCCGAAGTTCCAGGG + Exonic
968626243 4:1627928-1627950 AGGAGGACCCTGAAGGTAGATGG - Intronic
969049943 4:4365582-4365604 GGGGTGACCCTGAAGGTACAAGG + Intronic
977196886 4:94073941-94073963 AGGGGGGCCATGGAGTTACCTGG - Intergenic
982031153 4:151302082-151302104 TGGGGGTCCTGCAAGTTACATGG - Intronic
988044378 5:25931185-25931207 AGGGTTTCCCTGGAGTTACTAGG + Intergenic
990330210 5:54718564-54718586 GGGGGGTCCCTGGAGCCACATGG - Intergenic
997721127 5:136079226-136079248 AGGGGGTCCGTGAATCTCCAAGG + Intergenic
1001334237 5:170784304-170784326 TGGGGGTCACTGTATTTACATGG + Intronic
1003631974 6:7795443-7795465 TGGGGATCCCTGAACTAACAGGG - Intronic
1006967537 6:38003844-38003866 AGGGGTTCCCTGAAGGCAGAAGG - Intronic
1009400171 6:63245254-63245276 AGGGGATGCATGAAGTTACTTGG + Intergenic
1017747595 6:157460819-157460841 AGGGTTTCCCTGAAGATGCAGGG + Intronic
1018580995 6:165308347-165308369 AGGGGGTCAGGGAAGTTGCAAGG + Intronic
1018709873 6:166490707-166490729 ACGGGGTCCCTGCCGTTCCAGGG - Exonic
1021199379 7:17711087-17711109 AGGGGCTCCCTGCTGCTACAAGG + Intergenic
1021456812 7:20838707-20838729 AGGGGCACCGTGAAGGTACAGGG - Intergenic
1022169368 7:27809438-27809460 AGGAGGTCCATGAACTTACATGG - Intronic
1023827154 7:44017300-44017322 AGAGAGGCCCTGAAGTTACACGG + Intergenic
1025062357 7:55821332-55821354 AGTGGGTGCCTGAAGCTTCAGGG + Intronic
1029738306 7:102477046-102477068 AGAGAGGCCCTGAAGTTACACGG + Intronic
1029755436 7:102570702-102570724 AGAGAGGCCCTGAAGTTACACGG + Intronic
1029773385 7:102669782-102669804 AGAGAGGCCCTGAAGTTACACGG + Intronic
1032062059 7:128733138-128733160 AGGGGGTCCTTGATGTTGCCTGG + Intergenic
1032800746 7:135315815-135315837 TGAGGCTCCCTGAGGTTACAAGG + Intergenic
1035311174 7:157969945-157969967 ACGGGATCCCTGAAGGTGCAGGG + Intronic
1039742759 8:40397402-40397424 TGGGGGTTCCTGCAGTCACAGGG + Intergenic
1040532267 8:48275493-48275515 AGGGGCTTGCTGAAGTGACAAGG + Intergenic
1049084028 8:140464075-140464097 AGAGGGTCCCTGAGGTAAGATGG + Intergenic
1052104798 9:24499733-24499755 AGGGACTCCATTAAGTTACAGGG + Intergenic
1053051792 9:34967716-34967738 AGTGGGTTCTTGAAGTGACAGGG - Intronic
1055158282 9:73092424-73092446 AGCAGTTCCCTGAAGTTACATGG - Intergenic
1056304645 9:85277935-85277957 AAAGAGGCCCTGAAGTTACAAGG + Intergenic
1057700794 9:97361947-97361969 AGCTGGTCCCTGAAGGTCCAGGG - Intronic
1057941813 9:99291715-99291737 AGGGGTTCTCTGAAGTTTCCTGG - Intergenic
1059054241 9:110962081-110962103 AGGGCAACACTGAAGTTACAGGG - Intronic
1059139089 9:111835054-111835076 TGGGGGTGACTAAAGTTACATGG - Intergenic
1060040288 9:120294523-120294545 AGGGGCTTCCTGAAGTTAGTTGG - Intergenic
1060547554 9:124470108-124470130 AGGGGGTCCCTGAAAAGCCAGGG + Intronic
1062624219 9:137435666-137435688 CGAGGGTCCCTGAGGGTACAGGG - Intronic
1185963694 X:4575964-4575986 AGGGGGTCCATGATGTCAAAAGG + Intergenic
1188964272 X:36531669-36531691 AGGAGGTCACTGAAGTGAAAGGG - Intergenic
1192542858 X:71989911-71989933 ACGTGGTCCCTGAGGTGACATGG + Intergenic
1192640277 X:72855903-72855925 AGGGAGTCCTTCAAGTTAAAAGG + Intergenic
1192641434 X:72864873-72864895 AGGGAGTCCTTCAAGTTAAAAGG - Intergenic
1193424879 X:81329629-81329651 AGGGGGTCCCAAGAGTTACTTGG - Intergenic
1197295735 X:124716958-124716980 AGGGGGCACCTGAAGGTCCAAGG - Intronic