ID: 1123042974

View in Genome Browser
Species Human (GRCh38)
Location 14:105497985-105498007
Sequence GCTGGTGCCCAGAGCGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 417
Summary {0: 1, 1: 0, 2: 4, 3: 40, 4: 372}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123042974_1123042989 12 Left 1123042974 14:105497985-105498007 CCAGCCTCGCTCTGGGCACCAGC 0: 1
1: 0
2: 4
3: 40
4: 372
Right 1123042989 14:105498020-105498042 TCGGGGGATGGCTGACCTGAGGG 0: 1
1: 0
2: 1
3: 1
4: 97
1123042974_1123042990 20 Left 1123042974 14:105497985-105498007 CCAGCCTCGCTCTGGGCACCAGC 0: 1
1: 0
2: 4
3: 40
4: 372
Right 1123042990 14:105498028-105498050 TGGCTGACCTGAGGGCACTTTGG 0: 1
1: 0
2: 0
3: 15
4: 168
1123042974_1123042977 -6 Left 1123042974 14:105497985-105498007 CCAGCCTCGCTCTGGGCACCAGC 0: 1
1: 0
2: 4
3: 40
4: 372
Right 1123042977 14:105498002-105498024 ACCAGCCCAGCCCCACCTTCGGG 0: 1
1: 0
2: 5
3: 64
4: 493
1123042974_1123042976 -7 Left 1123042974 14:105497985-105498007 CCAGCCTCGCTCTGGGCACCAGC 0: 1
1: 0
2: 4
3: 40
4: 372
Right 1123042976 14:105498001-105498023 CACCAGCCCAGCCCCACCTTCGG 0: 1
1: 0
2: 4
3: 38
4: 383
1123042974_1123042979 -5 Left 1123042974 14:105497985-105498007 CCAGCCTCGCTCTGGGCACCAGC 0: 1
1: 0
2: 4
3: 40
4: 372
Right 1123042979 14:105498003-105498025 CCAGCCCAGCCCCACCTTCGGGG 0: 1
1: 0
2: 4
3: 47
4: 398
1123042974_1123042980 -4 Left 1123042974 14:105497985-105498007 CCAGCCTCGCTCTGGGCACCAGC 0: 1
1: 0
2: 4
3: 40
4: 372
Right 1123042980 14:105498004-105498026 CAGCCCAGCCCCACCTTCGGGGG 0: 1
1: 0
2: 0
3: 24
4: 234
1123042974_1123042983 0 Left 1123042974 14:105497985-105498007 CCAGCCTCGCTCTGGGCACCAGC 0: 1
1: 0
2: 4
3: 40
4: 372
Right 1123042983 14:105498008-105498030 CCAGCCCCACCTTCGGGGGATGG 0: 1
1: 0
2: 1
3: 17
4: 234
1123042974_1123042988 11 Left 1123042974 14:105497985-105498007 CCAGCCTCGCTCTGGGCACCAGC 0: 1
1: 0
2: 4
3: 40
4: 372
Right 1123042988 14:105498019-105498041 TTCGGGGGATGGCTGACCTGAGG 0: 1
1: 0
2: 1
3: 5
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123042974 Original CRISPR GCTGGTGCCCAGAGCGAGGC TGG (reversed) Intronic
900207833 1:1439187-1439209 GCTGGTGCCCAGCGCCCAGCCGG + Exonic
900332769 1:2144457-2144479 GCTGCAGCCCAGAGCTAGGACGG - Intronic
900403568 1:2482769-2482791 GCTGGTCCCCAGTGGCAGGCTGG + Intronic
900605863 1:3523280-3523302 GCCTGTGCCCAGAGCCAGCCAGG + Intronic
900611343 1:3545820-3545842 GCTTGTGGCCAGCGGGAGGCTGG - Intronic
900921906 1:5678081-5678103 GCTGGAGCCCAGAGGAAGTCAGG + Intergenic
900939186 1:5786906-5786928 GCTGGTGTGCAGAGGAAGGCAGG - Intergenic
901346889 1:8552772-8552794 GCTGCTGCCAAGAGCGAGGCCGG + Intronic
902374322 1:16023188-16023210 GCTGGTGCCCACAGCCAGTGAGG + Intronic
902379279 1:16045065-16045087 GCTGGTGCCCACAGCCAGTGAGG + Intronic
902628558 1:17690803-17690825 GCTGGGGACCAGAGCGTGGGGGG + Intronic
902634092 1:17723887-17723909 GTTGGTGCTGAGAGCGGGGCTGG + Intergenic
902676116 1:18009539-18009561 GCTGGTTCCCAGAGCCAAGAGGG - Intergenic
904272097 1:29356808-29356830 GCAGGTGCGCAGGGCGAGGGTGG + Intergenic
904300184 1:29549166-29549188 GCTTGAGCCCAGGGCCAGGCAGG + Intergenic
904333922 1:29784924-29784946 GGTGATGCCCAGAGCCTGGCAGG - Intergenic
904616697 1:31753873-31753895 ACTGGTGCCCAGAGCTGGGCTGG - Intronic
905616977 1:39408470-39408492 GATGGAGCCGAGAGCGATGCAGG + Intronic
906283475 1:44569855-44569877 GCTGGGGCCCAGGACGATGCGGG - Intronic
907220603 1:52904698-52904720 GCTGTGGCCCAGAACGAGGAGGG - Exonic
908888515 1:68817571-68817593 GGAGGCGCCCAGAGCGAGGCAGG - Intergenic
909820564 1:80053976-80053998 GGAGGTGCCCAGAGCGAGCGAGG + Intergenic
910621414 1:89259737-89259759 CCTGGTACCCTGAGCCAGGCGGG + Intronic
912547418 1:110460936-110460958 CCTGGTATCCAGAGGGAGGCCGG + Intergenic
912843454 1:113059385-113059407 GCTGGTGAACAGAGTGAGGCTGG + Intergenic
915356054 1:155255624-155255646 GCCAGGGTCCAGAGCGAGGCAGG - Intergenic
915587582 1:156852501-156852523 CCTGGTGCCCAGATCATGGCTGG + Intronic
915814331 1:158950690-158950712 GCTTGTGCCAATAGCGTGGCAGG + Intronic
917348943 1:174056875-174056897 GCAGGCGCCAAGAGCGAGGGAGG + Intergenic
918474696 1:184911438-184911460 CCTGGTGCCCAGAGCTCTGCTGG - Intronic
922289890 1:224201359-224201381 GCTGGGGCTTAGAGTGAGGCTGG - Intergenic
922874448 1:228928928-228928950 GCTGGTGCCCTGAGGAAGGGAGG + Intergenic
924543311 1:245001552-245001574 GGTGGTGTCAAGAGCAAGGCAGG + Intronic
1062858232 10:790198-790220 ACTGCTGCCCTGAGTGAGGCCGG - Intergenic
1062919599 10:1269924-1269946 GCTGGTGGCCAGGGTGGGGCTGG + Intronic
1063369606 10:5512522-5512544 GCAGGTGCCCACGGCGAGGAAGG - Intergenic
1065441259 10:25755852-25755874 GGAGGTGCCGAGAGCGAGGGAGG - Intergenic
1067062178 10:43083166-43083188 GCTGGGTCCCATAGCCAGGCTGG - Intronic
1068327881 10:55518519-55518541 GCTGGGGCACAGAGGGAGGTTGG + Intronic
1068388387 10:56360750-56360772 GCTGGTGCTCAGCGCCAGGAGGG - Intronic
1068555030 10:58448750-58448772 GGAGGTGCCAAGAGCGAGCCAGG + Intergenic
1069782855 10:70967795-70967817 GCTGGTGTCTGGAGCCAGGCAGG - Intergenic
1070937822 10:80315289-80315311 GGAGGTGCCCAGAGCGAGGAAGG - Intergenic
1072533995 10:96345946-96345968 GCTTGTGCCCAGACTGAGCCTGG - Exonic
1072679868 10:97498875-97498897 CCTGGTGCCCCGAGCGAGCCGGG + Exonic
1073280052 10:102347388-102347410 GGTGGTGCTCAGGGCAAGGCTGG - Intronic
1074317068 10:112370163-112370185 GGAGGTGCCCAGAGCGAGCGAGG - Intergenic
1074882058 10:117667222-117667244 GCTGAAGCCCAGAGAGAGGTTGG + Intergenic
1075225503 10:120625230-120625252 GCTGATGCCCACAACTAGGCTGG - Intergenic
1076361408 10:129892024-129892046 GCCGTTGGCCAGAGAGAGGCGGG - Intronic
1076684237 10:132189897-132189919 GTCGGTGCCCAGAGCTTGGCAGG - Intronic
1076720470 10:132390134-132390156 GCCTGTGTCCAGAGCGGGGCGGG - Intergenic
1076833664 10:133009356-133009378 GCTGGCGCCCTGAGAGAGGGTGG - Intergenic
1077024630 11:433714-433736 GCGGGTGCCCAGCGAGGGGCAGG - Intronic
1077024662 11:433788-433810 GCGGGTGCCCAGCGAGGGGCAGG - Intronic
1077373871 11:2196054-2196076 GCTGGAGCCCAGAGCCAGCTGGG - Intergenic
1077841686 11:5982518-5982540 GCTGGGACCCAGAAAGAGGCTGG + Intergenic
1078470310 11:11581083-11581105 GCTGGTGTCCCGAGAGAAGCCGG + Intronic
1084110835 11:67013378-67013400 GCTGGTGCTCAGGGCCTGGCAGG + Intronic
1084249842 11:67888899-67888921 GGGGGAGCCCAGAGCGAGCCCGG + Intergenic
1084973063 11:72781784-72781806 GCTGGGGCCCGGGGCGGGGCCGG - Intronic
1085417282 11:76327859-76327881 TCTGGTGGCCAGAGCTGGGCTGG + Intergenic
1085646522 11:78227024-78227046 TCTGGTGCCCTGAGAGAAGCTGG + Exonic
1085863051 11:80257414-80257436 GGAGGTGCCCAGAGCGAGCGAGG - Intergenic
1086034828 11:82403753-82403775 GGAGGTGCCCAGAGCGAGCGAGG - Intergenic
1087144498 11:94798721-94798743 GATGGTGCATAGAGAGAGGCAGG + Intronic
1088814327 11:113410943-113410965 GCTGGTCCCCAGAGCCGGGGAGG + Intronic
1089469085 11:118706526-118706548 GCAGGTGGCCAGAGGGAGACAGG - Intergenic
1089539797 11:119182949-119182971 GCTGCTGGCCAGTGGGAGGCAGG - Intronic
1089666788 11:120025750-120025772 GCAGGAGCCGAGAGCGAGCCAGG - Intergenic
1090217702 11:124984384-124984406 GCTGGGGCCCTGGGAGAGGCTGG + Intronic
1090346407 11:126075192-126075214 CCTGGGGGCCAGAGAGAGGCTGG + Intergenic
1090929058 11:131279007-131279029 GCTAGTGCCCTGGGCGATGCGGG + Intergenic
1092758685 12:11789454-11789476 GCTGAAGCCCAGACCGAAGCAGG - Intronic
1093034415 12:14319946-14319968 GGAGGCGCCCAGAGCGAGCCAGG - Intergenic
1097160607 12:57044083-57044105 GTGGGTGCCCAGGGTGAGGCAGG - Intronic
1097186008 12:57196868-57196890 GCTGCTGCCCCTAGTGAGGCCGG + Intronic
1098162068 12:67655378-67655400 GAGGGTGCAGAGAGCGAGGCTGG + Intronic
1098595792 12:72272434-72272456 CCCGGTGTCCAGAGTGAGGCGGG + Intronic
1100370505 12:93964936-93964958 TTTGGTGCCCAAAGCCAGGCAGG + Intergenic
1102346955 12:112166740-112166762 GCGAGTGCCCAGAGCCTGGCTGG + Intronic
1102349141 12:112179368-112179390 GCTGGTGCCCGGAGCCAGAGAGG - Exonic
1103943310 12:124512651-124512673 GCTTGGGCTCAGAGCTAGGCAGG - Intronic
1104004129 12:124880257-124880279 GCTGGAGCCCACAGAGAAGCTGG + Intronic
1104164795 12:126217090-126217112 GCTGGTCCCCAGTGAAAGGCAGG - Intergenic
1104236316 12:126941294-126941316 GCTGGTGACAAGAGCTGGGCAGG - Intergenic
1104814850 12:131639723-131639745 GCTGGTGCCCATAGCAGGGACGG - Intergenic
1104904762 12:132207297-132207319 CCCAGTGCTCAGAGCGAGGCCGG + Intronic
1105962671 13:25356186-25356208 CCTGGAGCCCAGAGTGGGGCAGG + Intergenic
1107658697 13:42617034-42617056 CCTGGCTCCCAGAGAGAGGCAGG + Intergenic
1108522091 13:51255769-51255791 GCTGCTGCACAGGGGGAGGCTGG + Intronic
1111051721 13:82891367-82891389 GCTGGTGTCCAGAGATAGGGTGG - Intergenic
1111841496 13:93455294-93455316 GGAGGCGCCCAGAGCGAGGGAGG + Intronic
1112563428 13:100533122-100533144 GCTGGTGCCCTCAGGGAGTCGGG - Intronic
1115029298 14:28774981-28775003 GTTGTTGGCCAGAGGGAGGCCGG + Intronic
1116397455 14:44463546-44463568 GCTGGGGCACAGAGGGAGGTTGG - Intergenic
1117647290 14:57865688-57865710 GCGGCTGCCCTGCGCGAGGCGGG - Intronic
1118599507 14:67461994-67462016 GCTGGTGCCCAGAGCCTCCCTGG - Intronic
1118878043 14:69801453-69801475 GCTGGGGCCCGGAACCAGGCTGG - Intergenic
1118901909 14:69993247-69993269 GCTGGTGGCAAAAGAGAGGCTGG + Intronic
1119048013 14:71338049-71338071 GCTGGTGCCCAGAGGGAAAAGGG - Intronic
1119399074 14:74349561-74349583 GCTAGAGCCCAGAATGAGGCTGG + Intronic
1121511225 14:94514748-94514770 GTTGGTGGCCAGAGGTAGGCAGG + Intronic
1121605029 14:95234286-95234308 GCCGGTGACCAGAGCAATGCTGG - Intronic
1122134584 14:99625512-99625534 GCTAGTGCCCACAATGAGGCAGG + Intergenic
1122148115 14:99706232-99706254 GCTGGTGCCCAGGGCAGGGCAGG + Intronic
1122152187 14:99731280-99731302 GCTGGAGCCCGGGGTGAGGCTGG - Intergenic
1122211980 14:100179185-100179207 GCTGGGTCCCAGCGCCAGGCAGG - Intergenic
1122218170 14:100218095-100218117 GCTGGTGGCCAGAGCCCTGCCGG - Intergenic
1122276397 14:100592928-100592950 GAGGGTGCCCAGAGCCCGGCAGG + Intergenic
1122790615 14:104182761-104182783 GCTGGTCCCAGGAGGGAGGCTGG + Intergenic
1122829616 14:104389413-104389435 GCTGATGCCCAGAGAGATGTGGG + Intergenic
1123042974 14:105497985-105498007 GCTGGTGCCCAGAGCGAGGCTGG - Intronic
1123853229 15:24381584-24381606 GCTTTTGCCCAGAGGAAGGCGGG + Intergenic
1123883408 15:24697070-24697092 GCTTGTGCCCAGAGAGAGAAAGG - Intergenic
1123885999 15:24728851-24728873 ACTGGTGTCCAGTGCAAGGCAGG + Intergenic
1124372068 15:29109684-29109706 GCTGGTGCCCAGAACGAAGAGGG + Intronic
1124645957 15:31437680-31437702 GCTGCTGGCCAGGGCGAGCCAGG + Intergenic
1125732198 15:41899272-41899294 GCTGGTGCCCACAGAGGGGGAGG + Exonic
1126096828 15:45095969-45095991 GGTGGTCCCCAGAGCCAGGCAGG + Exonic
1127901694 15:63345719-63345741 CCTGGAGCCCAGAGAGAGGCAGG + Intronic
1127965359 15:63918929-63918951 GCTGGTGCCTAGAGGAAGGAAGG - Intronic
1127994763 15:64147094-64147116 GCCGGTGACCAGAGCTGGGCTGG + Intergenic
1129254673 15:74327288-74327310 GCTGGGGCCCAGAGCGAGGAAGG - Intronic
1129377779 15:75145080-75145102 GCTGGTGCCCAAAGTCAGGAGGG + Intergenic
1129467697 15:75733103-75733125 GCTGATGCCCAGAGAAAGGAGGG + Intergenic
1129659068 15:77543065-77543087 ACTGAGGCCCAGAGAGAGGCAGG - Intergenic
1132698719 16:1213203-1213225 GCTGGTGGCCAGAGGAGGGCAGG + Intronic
1132951375 16:2564248-2564270 GCTCGTGCTCAGAGCCAGGCTGG - Intronic
1132962975 16:2635922-2635944 GCTCGTGCTCAGAGCCAGGCTGG + Intergenic
1133001256 16:2852830-2852852 GCTGGGGCCCGGGGCGGGGCCGG + Exonic
1133839676 16:9396189-9396211 GGTGGGGCCCAGAGGAAGGCAGG - Intergenic
1134112104 16:11522078-11522100 TCTGGTGCCCACAGGGAGGTGGG + Exonic
1134453197 16:14376003-14376025 ACAGGTCCCCAGAGAGAGGCAGG + Intergenic
1134456327 16:14398183-14398205 ACTGGTGCCCACAACGAGCCAGG + Intergenic
1134876154 16:17700776-17700798 GTTGGTGCCCAGACCTAGTCTGG - Intergenic
1135025819 16:18998328-18998350 GCTGGTGTCCAAATCCAGGCAGG + Intronic
1135262203 16:20990149-20990171 GGAGGCGCCCAGAGCGAGCCAGG + Intronic
1136347349 16:29684681-29684703 GGTGGTGCCCAGAGGGTGGTAGG - Intronic
1137275000 16:46927542-46927564 GCCGGTGCCCAGAGCTGAGCTGG + Intronic
1137693424 16:50445732-50445754 GCTGGGGCCCAGGCAGAGGCCGG + Intergenic
1138389669 16:56661303-56661325 GATGGTGCGCAGAGGGAGGAAGG - Intronic
1138525037 16:57600312-57600334 ACTGGAGCCCAGAGAGGGGCAGG - Intergenic
1139955518 16:70691291-70691313 GCTGGTTCCCACAGGGAGACTGG + Intronic
1141180902 16:81752789-81752811 GGAGGTGCCCAGTGCTAGGCTGG - Intronic
1141656915 16:85421447-85421469 GCTGGGGCACAGAGAGGGGCAGG + Intergenic
1142037150 16:87869415-87869437 GCCGGTGCGCAGAGCATGGCGGG - Exonic
1142112663 16:88340614-88340636 GCTGAGGCCCAGAGGGAGGAAGG + Intergenic
1142218129 16:88839818-88839840 GCCGGTGGCCAGAGCTAGACAGG - Intronic
1142355425 16:89599377-89599399 GCTGGGGCCCTGAGCGGGTCGGG + Intergenic
1142802172 17:2353173-2353195 GCAGGTGACCTGAGCGGGGCAGG - Intronic
1142921388 17:3190150-3190172 GCTTGGGCACAGAGGGAGGCGGG - Intergenic
1143968692 17:10776466-10776488 GCAGGTGACCTGAGCCAGGCAGG + Intergenic
1144437645 17:15255848-15255870 CCAGGTGCCCAAAGGGAGGCAGG - Intronic
1144736308 17:17557494-17557516 CCTGGGTCCCAGAGCGAGCCAGG - Intronic
1147725847 17:42565806-42565828 GTTGGTGCCCAGGGCAAGGCCGG + Intronic
1148748654 17:49932149-49932171 GCTGGGGCCCAGATGCAGGCTGG + Intergenic
1148841662 17:50502680-50502702 CCTTCTGCCCAGAGCGAGGATGG + Intergenic
1148957465 17:51365568-51365590 GCTGGTGCCCAGAGAGAGAAAGG - Intergenic
1149661119 17:58334426-58334448 GCTGGTTCCCATCCCGAGGCTGG + Intergenic
1150136212 17:62696746-62696768 CCAGGTGGCCAGAGCGGGGCGGG - Intergenic
1151000452 17:70369555-70369577 GCTGGTGCCCAGAGGGTGAGAGG + Intergenic
1151265914 17:72954780-72954802 GCAGCTGCCCAGGGCCAGGCTGG + Intronic
1151921008 17:77155492-77155514 GCTGGTGCCCAGATGGGAGCTGG + Intronic
1151974980 17:77479676-77479698 CCTGGAGCCCAGAGCGAGGGAGG - Intronic
1152103481 17:78316009-78316031 GTGGGTGCACAGATCGAGGCTGG - Intergenic
1152258984 17:79256391-79256413 GCTGAAGCCCAGAGTGAGGATGG + Intronic
1152277223 17:79364900-79364922 CCTGGTGCCCAGGGAGTGGCTGG + Intronic
1152706129 17:81844582-81844604 GCTGGTGCACAGTGGGAGGTGGG - Intronic
1152730346 17:81966944-81966966 GCTGGAGCCCAGAGCGGCCCTGG - Intergenic
1153226847 18:2906495-2906517 GCCGGAGCCAAGAGTGAGGCCGG + Intronic
1153527835 18:6014650-6014672 GCTGGAGCTCAGAGTGGGGCAGG + Intronic
1153636250 18:7116408-7116430 TCTGCTGCGCAGAGCCAGGCTGG - Intronic
1157222683 18:45838820-45838842 GCTGTTGCCCAGGGCCGGGCCGG - Exonic
1157581422 18:48776264-48776286 GCTGGTGCACAAAGAGGGGCTGG - Intronic
1158649345 18:59272673-59272695 GCCAGTGCCCACAGCGAGGCGGG - Intronic
1159743995 18:72209408-72209430 GCAGGAGCCCACGGCGAGGCGGG - Intergenic
1160514219 18:79469686-79469708 GCTGGTGCCCAGGGTGAGCCTGG - Intronic
1160860156 19:1234290-1234312 GCTGGGGCCCACAGAGCGGCCGG + Exonic
1160965155 19:1744201-1744223 GCTGGTGCCCACAGGGAAACTGG + Intergenic
1161719460 19:5895025-5895047 ACTGATGCACAGAGGGAGGCCGG + Intronic
1161990556 19:7681757-7681779 GCTGGAGCGCAGGGCGGGGCAGG + Intronic
1162496237 19:11024801-11024823 GCTGGTGAGGAGAGCCAGGCAGG - Intronic
1163086936 19:14988256-14988278 GCTGGGGCACAGAGGGAGGTGGG - Intronic
1163404192 19:17112403-17112425 GCCAGTGGCCAGAGGGAGGCTGG + Intronic
1163410417 19:17150490-17150512 GCTGGTGCCCAAGGAGTGGCAGG - Intronic
1163502594 19:17685940-17685962 GATGGTGCCCAGAGAGGGGAGGG - Intronic
1166147271 19:40846223-40846245 GCTGGAACCTAGAGCGAGTCTGG - Intronic
1166151424 19:40878119-40878141 GCTGGAACCTAGAGCGAGTCTGG - Intronic
1167116666 19:47492683-47492705 GGAGGGGCCCAGAGTGAGGCTGG - Intronic
1167747776 19:51362926-51362948 GCTTGTCCCCAGAGGGAAGCTGG - Intronic
1168154098 19:54463638-54463660 CGTGGTCCCCAGAGCTAGGCCGG - Exonic
925198233 2:1945106-1945128 GCTGGAGCATAGAGCGGGGCTGG + Intronic
925900210 2:8503878-8503900 GCTGGTGCCCAGACTGAGGGTGG - Intergenic
926040547 2:9669353-9669375 GCTGGGGGTCAGAGCGAGGTTGG - Intergenic
926313898 2:11695695-11695717 GCGGGTGGCCAGAGGGAAGCTGG + Intronic
927717118 2:25360077-25360099 GCTCTTGCCCAGAGAGTGGCAGG + Intergenic
929917113 2:46145262-46145284 CCTGGTGCCAGGACCGAGGCAGG + Intronic
932681430 2:73829117-73829139 TCGGGTGCCTCGAGCGAGGCAGG - Exonic
933060917 2:77735263-77735285 GGAGGCGCCCAGAGCGAGGGAGG + Intergenic
934576635 2:95405855-95405877 GCTGTTTCCCAGAGCGGGGAGGG - Intronic
934794794 2:97091388-97091410 GCTGTTTCCCAGAGCGGGGAGGG + Intronic
935349204 2:102139408-102139430 GGTGGTGTCCAGAACTAGGCTGG + Intronic
936721715 2:115259163-115259185 CCTGGTGCCCAAAGGGAGGAAGG + Intronic
937299883 2:120832618-120832640 GCTTCTGCCCAGGGTGAGGCTGG + Intronic
937983016 2:127625884-127625906 GCTGAGGCCCAGAGGCAGGCAGG - Intronic
939252913 2:139706036-139706058 GTTGGTGCACAGAGGGAGGCAGG + Intergenic
940145871 2:150543065-150543087 GCAGGTGCCAAGAGCGAGCGAGG + Intergenic
941560703 2:167040729-167040751 GCTGGTGGCCATAGCCAGACAGG - Intronic
946397941 2:219452702-219452724 GTTGGTGCCCTGAAGGAGGCTGG + Intronic
947158288 2:227185934-227185956 GGTGATGCCCAGAGAGAGGCAGG - Intronic
947637832 2:231689026-231689048 GCTGGTGCCCAGAGCTGCCCTGG + Intergenic
947739840 2:232480048-232480070 GGTGGTGCCCAGAGCGGGGCTGG + Exonic
948368697 2:237474447-237474469 GCTTGGCCCCAGAGCGGGGCAGG + Intergenic
948388301 2:237595313-237595335 CCAGGTGCCCAGAGCCTGGCGGG + Exonic
948778852 2:240304740-240304762 GATGCTGCCCAGAGCCATGCTGG + Intergenic
948804384 2:240447164-240447186 GCTGGACCCCAGAGCCAGGAGGG + Intronic
948867330 2:240782632-240782654 GCTGAGGCCCGGAGCGAAGCTGG + Intronic
1169235992 20:3930448-3930470 GCTGGTGCCCAGAGCCTGGTAGG - Intronic
1171293441 20:23995591-23995613 GCAGCTGCCCAGAGGGAAGCAGG - Intergenic
1172766264 20:37352687-37352709 GCTGAAGCTCAGAGAGAGGCGGG + Intronic
1172944508 20:38676830-38676852 GCTGGTGTCCAAACCCAGGCAGG + Intergenic
1174056648 20:47802834-47802856 GCTGGTGCCTAGAGCATGCCTGG - Intergenic
1174066105 20:47867277-47867299 GTGGCTGCACAGAGCGAGGCTGG - Intergenic
1174189105 20:48727666-48727688 GCTGGGACCTAGAGCCAGGCGGG + Intronic
1174519482 20:51118588-51118610 GCGGGTGCCTAGAGGGAGCCAGG - Intergenic
1174616228 20:51837674-51837696 GCTGTTGCCCAGACAGTGGCAGG - Intergenic
1175963170 20:62647296-62647318 GCAGGTGCTCAGGGCGGGGCTGG + Intronic
1175966067 20:62660829-62660851 GCTGGGGCCCAAAGTGGGGCTGG - Intronic
1175983544 20:62753224-62753246 GCCGGTGCCCAGAGGGGGCCAGG + Intronic
1176038745 20:63053198-63053220 CCTGGGGCCCAGAGCGGGGCTGG - Intergenic
1176045282 20:63089496-63089518 GCAGGTGACCAGACAGAGGCTGG + Intergenic
1176048158 20:63103189-63103211 GTTGGGGCCCTGAGCGAGGCTGG - Intergenic
1176189442 20:63800914-63800936 GCAGGTGCACAGAGCGGGACTGG + Intronic
1176285273 21:5016067-5016089 CCTGGTTCCCAGAAGGAGGCTGG + Intergenic
1176308392 21:5136318-5136340 GCTGGGGCTCACAGCGAGGATGG + Intronic
1176427506 21:6557824-6557846 GCTGGTGCCCAGCCCCAGGTTGG + Intergenic
1177318654 21:19493461-19493483 GGAGGCGCCCAGAGCGAGCCAGG - Intergenic
1178948278 21:36966272-36966294 CCCGGGGCCCAGAGAGAGGCCGG - Intronic
1179591765 21:42413698-42413720 GCTGGTGCACACAGGGAGTCAGG + Intronic
1179702997 21:43166141-43166163 GCTGGTGCCCAGCCCCAGGTTGG + Intergenic
1179848668 21:44125714-44125736 GCTGGGGCTCACAGCGAGGATGG - Intronic
1179871908 21:44247408-44247430 CCTGGTTCCCAGAAGGAGGCTGG - Intronic
1180694268 22:17742024-17742046 GCTGGTGGCCAGAGGGAGAGAGG - Intronic
1180921779 22:19524939-19524961 GCTGGGACTCAGAGCGGGGCTGG - Intronic
1181013319 22:20054684-20054706 GCTGGTGCCAGGGCCGAGGCTGG + Intronic
1181501280 22:23316994-23317016 GCAGCTGCCCAGAGGGAAGCAGG + Exonic
1181650872 22:24258424-24258446 GCAGCTGCCCAGAGGGAAGCAGG - Intergenic
1181706509 22:24652315-24652337 GCAGCTGCCCAGAGGGAAGCAGG + Intergenic
1182766691 22:32762681-32762703 GCTGATGGACAGAGCGAGGTGGG + Intronic
1183292420 22:37010830-37010852 GATGGAGCCCAGAGAGAGGCAGG + Intergenic
1183301335 22:37060559-37060581 GCTGTTACATAGAGCGAGGCTGG - Intronic
1183479075 22:38052961-38052983 GGTGGTGCCCAGGCTGAGGCAGG - Intergenic
1184161190 22:42698319-42698341 GCTGGTGCCAAGAACCTGGCTGG - Intronic
1184459352 22:44628317-44628339 GCTGGTGCCCTGAGCCATGCTGG + Intergenic
1184583628 22:45433423-45433445 GCTGCTGGCCAGAGCGTGGCAGG - Intergenic
1184596820 22:45518938-45518960 GCCGGTGCCAGGAGGGAGGCAGG - Intronic
1184691722 22:46120285-46120307 CAGGGAGCCCAGAGCGAGGCTGG + Intergenic
1184906331 22:47488815-47488837 GGAGGTGCCCAGAGCGAGCGAGG + Intergenic
1185139766 22:49093724-49093746 TCTGGTCCTCAGAGCGAGGCCGG - Intergenic
1185315986 22:50179333-50179355 GCTGGTGTCCACCGGGAGGCTGG - Exonic
1185384418 22:50525335-50525357 GCTGGAGGCCGGAGCGAGGCTGG - Intronic
950111883 3:10423915-10423937 GCTGGCGCCCAGAGCCTGGGTGG + Intronic
950576550 3:13835493-13835515 GGGGGTGGCCAGAGCCAGGCAGG - Intronic
951462893 3:22970009-22970031 GGTGGTGCTCAGCACGAGGCTGG + Intergenic
952322857 3:32294467-32294489 GCTGTTGCCCAGAGCCAGGTGGG + Intronic
953493680 3:43369288-43369310 GGTGCTGCCCTGAGCAAGGCAGG - Intronic
953529575 3:43728060-43728082 ACTGGTGGGCAGAGCAAGGCCGG - Intronic
953582979 3:44173538-44173560 GGAGGTGCCCAGAGCGAGCGAGG + Intergenic
954152112 3:48662768-48662790 GATGGTGCCCAGAGGGCGGCGGG - Exonic
954333738 3:49904220-49904242 GCTGGTGCCCAGAGGTGGCCTGG + Intronic
961446245 3:126983064-126983086 GCGGGCGGCGAGAGCGAGGCCGG + Intergenic
961474872 3:127140319-127140341 GCAGGTGCACAGAGTGGGGCTGG + Intergenic
961597718 3:128032124-128032146 GCTGGGGTGCAGAGTGAGGCAGG - Intergenic
962583784 3:136820409-136820431 GCTGGTGGCCAGAGTGGAGCAGG + Intronic
964381025 3:156099320-156099342 GGAGGCGCCCAGAGCGAGCCAGG - Intronic
966246152 3:177809404-177809426 GGAGGTGCCCAGAGCGAGCGAGG + Intergenic
966952874 3:184839599-184839621 TCTGGTGCCTAGAGGAAGGCAGG + Intronic
968285554 3:197506553-197506575 ACTGGGGCCCAGAGCTGGGCTGG - Intergenic
968427673 4:534320-534342 GCTGGTGGCCAGATGGAGGGCGG + Intronic
968787412 4:2632922-2632944 CCTGGTGCCCAGAGAGACTCTGG + Intronic
968959021 4:3733480-3733502 ACTGCCGCCCAGAGCCAGGCAGG + Intergenic
969032625 4:4226821-4226843 GCAGCTGCCCGGGGCGAGGCGGG + Exonic
969249065 4:5955327-5955349 GCTGGGGTCCAAAGCCAGGCGGG + Intronic
969494948 4:7521159-7521181 GCTGGTGTCCAGAGCATGGTGGG + Intronic
973366467 4:49213248-49213270 GCTGGGGTGCAGGGCGAGGCAGG + Intergenic
973764369 4:54149746-54149768 GGAGGTGCCGAGAGCGAGGCAGG + Intronic
976137971 4:81959631-81959653 CCTGGGGCACAGAGCAAGGCAGG - Intronic
976690689 4:87864184-87864206 GGAGGTGCCCAGAGCGAGCGAGG + Intergenic
979223596 4:118259206-118259228 GCTGGTGCCCCGAGATAGGGTGG - Intergenic
979678686 4:123435877-123435899 GGAGGCGCCCAGAGCGAGGGAGG + Intergenic
982274047 4:153621828-153621850 CCTGCTGCCCAGAGAGAGGCAGG + Exonic
982361502 4:154524020-154524042 GCTGGAGCCCAGATGGAGGCTGG + Intergenic
983090287 4:163494482-163494504 CCTGGTGCTGAGTGCGAGGCTGG - Exonic
984265577 4:177495445-177495467 GGAGGTGCCCAGAGCGAGCGAGG - Intergenic
984905269 4:184620480-184620502 GCTGGTGCCCGGAATGTGGCAGG + Intergenic
985476447 5:81954-81976 GCCAGTGCCCAGGGTGAGGCTGG + Intergenic
985549947 5:528083-528105 GCTGGTGCCCTCAGGGAGCCAGG - Intergenic
985669701 5:1201077-1201099 TCTAGAGCCCAGAGCCAGGCTGG + Intergenic
986661661 5:10065332-10065354 GGAGGTGCCCAGAGCGAGCGAGG - Intergenic
988594343 5:32577770-32577792 GCTGGGGCCCAGCACTAGGCTGG - Intronic
989384332 5:40839372-40839394 GGTGGTTACCAGAGAGAGGCTGG + Intergenic
992105836 5:73448409-73448431 GCTGGGGCGCAGAGGGAGCCCGG - Intergenic
997645545 5:135479249-135479271 GCTGGTGGGCAGAATGAGGCAGG - Intergenic
998442997 5:142177680-142177702 GCTGGTGCCCTGGGTGAGGTTGG + Intergenic
999383904 5:151140896-151140918 GCTGGAGAGCAGAGCGGGGCTGG - Intronic
999406101 5:151309040-151309062 GGAGGTGCCCAGAGCGAGCTAGG - Intergenic
1000646169 5:163762916-163762938 GCTGGTGACCAGAACAAGGGAGG + Intergenic
1001095563 5:168773008-168773030 GCCAGGGCCCAGCGCGAGGCAGG - Intronic
1001309876 5:170603053-170603075 GCTGGTGCACACAGCAGGGCAGG + Intronic
1002817633 6:694480-694502 GGAGGTGCCCAGAGCGAGCGAGG - Intergenic
1003061971 6:2870590-2870612 GGAGGTGCCCAGAGCGAGCGAGG + Intergenic
1003148726 6:3530829-3530851 GATGGTGGCCTGAGTGAGGCTGG + Intergenic
1003881473 6:10483233-10483255 GCAGGTGCTGAGAGCGAGCCAGG + Intergenic
1004561946 6:16760501-16760523 GCGGGTGCCTGGAGCGCGGCTGG - Intronic
1005500685 6:26426579-26426601 GATGGAGCCCAGAGCGGGGATGG + Intergenic
1006429469 6:33986089-33986111 GCTGGAACCGAGAGAGAGGCTGG - Intergenic
1006454447 6:34123859-34123881 GCTGGAGACCAGAGAGAGGAAGG - Intronic
1006581576 6:35080582-35080604 TTTGGTTCCCAGAGCAAGGCTGG - Intronic
1006794284 6:36722009-36722031 TCCGGTGCCCACAGAGAGGCTGG + Exonic
1006910491 6:37560300-37560322 GATGGGGCCCAGAGTGAGACGGG + Intergenic
1007406083 6:41637194-41637216 GCGGGTGCCGAGAGCGCTGCCGG + Intronic
1007546253 6:42697107-42697129 CCTGGTGACCAGACCAAGGCAGG - Exonic
1007647709 6:43395763-43395785 TCTGTTTCCCAGAGCCAGGCTGG + Intergenic
1007727177 6:43923647-43923669 GCAGGTACCCAGAACTAGGCAGG - Intergenic
1008434340 6:51457448-51457470 GCTGCTTTCCAGAGGGAGGCTGG + Intergenic
1010716800 6:79239504-79239526 GCTGGTGCCAAGAGCCATCCAGG + Intergenic
1011381465 6:86746404-86746426 TCTGGAGCCCAGATCGGGGCAGG - Intergenic
1014751586 6:125262900-125262922 GCCAGTGCCCAGAGCTTGGCAGG + Exonic
1015404423 6:132821092-132821114 ACTGGTGCCCTGAGTGAGTCTGG - Intergenic
1018701797 6:166433113-166433135 GATGGTGCCCACTGCGAGGGTGG - Intronic
1018710891 6:166497610-166497632 GCTGGTGCCCAGGGCCTCGCTGG - Intronic
1018734762 6:166679606-166679628 GGAGGTGCCGAGAGCGAGCCAGG - Intronic
1019345901 7:530852-530874 CCTGGGGGCCAGAGCCAGGCAGG - Intergenic
1019441779 7:1051071-1051093 GCTGGTGCCCTCTGCGACGCAGG - Intronic
1019489111 7:1302938-1302960 GCTGGGCCCCAGACCAAGGCCGG + Intergenic
1019565961 7:1679259-1679281 GCTGGTGACCAGGGCTGGGCGGG + Intergenic
1022220546 7:28309549-28309571 GCTGGTGTTGAGAGCCAGGCTGG + Intronic
1022392447 7:29955281-29955303 TCTGCTCCCCAGAGCCAGGCGGG + Exonic
1022532205 7:31074052-31074074 ACTGGTGCCCAGAGGATGGCTGG - Intronic
1023564079 7:41506198-41506220 GTTGCAGCCCAGAGAGAGGCAGG - Intergenic
1024639722 7:51318839-51318861 GGTGGTGTCCAGAGCAAGGAGGG - Intergenic
1025236356 7:57237344-57237366 GCTGGTGCCTAGAGCATGCCTGG + Intergenic
1026893737 7:73998285-73998307 GGTGGGGGCCAGAGCCAGGCAGG + Intergenic
1028417682 7:90596774-90596796 GCTGGTGCCAGGAACGCGGCGGG - Intronic
1028727099 7:94100746-94100768 GGAGGTGCCCAGAGCGAGCAAGG - Intergenic
1029148635 7:98464693-98464715 GCTGGTGAGCACAGGGAGGCAGG + Intergenic
1029298382 7:99559125-99559147 GCAGGGGCCCAGGGCGAGGGTGG + Intronic
1029548079 7:101221867-101221889 TCTGGGGCCCAGAGCGTGGGTGG + Intronic
1030128613 7:106178377-106178399 GCTGGAGCTCAGAGCAAGGCTGG - Intergenic
1030418940 7:109282868-109282890 GCTGGGCCACAGAGAGAGGCAGG - Intergenic
1032087888 7:128893247-128893269 GCTGGCGGCCAGAGGCAGGCAGG + Exonic
1032215359 7:129952948-129952970 CACGGCGCCCAGAGCGAGGCTGG - Exonic
1033449466 7:141449655-141449677 TCTGGTACCCAGAGGGAGCCAGG - Intronic
1035036379 7:155897878-155897900 GCTGCTTCCCAGAGCCAGGCAGG + Intergenic
1035110584 7:156478545-156478567 GGTGCTGCCCAGCCCGAGGCAGG + Intergenic
1035318064 7:158009929-158009951 GCTGGTGCCCATGGTGGGGCAGG - Intronic
1035468010 7:159092238-159092260 GCTGGGGCCCAGAGCGAAATTGG + Intronic
1035534155 8:378441-378463 GGTGGTTCCCAGAGCCAGGAAGG + Intergenic
1035672159 8:1426410-1426432 GCAGGAGCCCAGAGCTAGGGAGG + Intergenic
1037373627 8:18205853-18205875 GCTGGGGCCCTGGGAGAGGCCGG + Intronic
1038895609 8:31778333-31778355 GGTGGTGACCAGAGAGAGGCTGG - Intronic
1039401675 8:37275179-37275201 GCTGCTGGGCAGAGCCAGGCAGG + Intergenic
1040514705 8:48125239-48125261 GAAGGTGCCCAGCGCCAGGCAGG - Intergenic
1041914447 8:63125962-63125984 GCAGGTGCCCAGAGCGAGCGGGG - Intergenic
1042784971 8:72536969-72536991 TCTGGTGCCCAGGGCGCGGCTGG - Intergenic
1045098312 8:98821160-98821182 GCTGGAGCCCAGAGCAAGGGCGG - Intronic
1045208143 8:100065270-100065292 GATGTCGCACAGAGCGAGGCAGG + Intronic
1046198812 8:110894710-110894732 GCTGGTGCCCAGAGAAAGAGAGG - Intergenic
1047160322 8:122370872-122370894 GATGGTGCCCAGACTGAGGGTGG - Intergenic
1047436484 8:124839327-124839349 CCAGGTGCCCAGGGAGAGGCAGG - Intergenic
1049061391 8:140278753-140278775 GCGGGTGCCCAGATGGAGCCTGG - Intronic
1049107737 8:140624228-140624250 GCTGCCTCCCAGAGTGAGGCAGG - Intronic
1049358356 8:142199788-142199810 GCTGGAGCCCTGTGGGAGGCGGG - Intergenic
1049536348 8:143184171-143184193 GCAGGGGCCCAGCCCGAGGCGGG + Intergenic
1049733576 8:144191756-144191778 TCTGCTGCCCAGTGAGAGGCTGG + Exonic
1052990342 9:34515383-34515405 GATGGTGCCCAGCTCTAGGCTGG + Intronic
1052994253 9:34541777-34541799 ACTGCTGCCCAGAGTGGGGCTGG - Intergenic
1054808142 9:69412516-69412538 GCTGGAGCCCAGAGGCAGGAGGG - Intergenic
1056492289 9:87119773-87119795 GGTGCTGCCCAGAGCGTGGAGGG - Intergenic
1056599434 9:88035133-88035155 GCTGCTGGCCAGAGCTAGGAGGG + Intergenic
1056735862 9:89209256-89209278 GGAGGTGCCCAGAGCGAGTGAGG - Intergenic
1058959271 9:109977767-109977789 GCTGATACCCAGAGAGAGGCAGG - Intronic
1059691145 9:116687313-116687335 GCGCGTGCGCAGAGGGAGGCAGG + Exonic
1059846093 9:118278604-118278626 GCTGGTGCTCATAGAGAGACAGG + Intergenic
1060116606 9:120946283-120946305 TCTGGTGCCCAGAGCCAGGCTGG + Intergenic
1060406850 9:123377064-123377086 GCTGGTGCCAGCAGCCAGGCTGG - Exonic
1061125922 9:128675690-128675712 TCTGGTTCCCAGAGGGAGCCTGG + Intergenic
1061226802 9:129285084-129285106 GCTGGAGACCAGAGCGGGCCAGG - Intergenic
1061399648 9:130361454-130361476 GCTGGTGGCCATATGGAGGCTGG + Intronic
1061919941 9:133777226-133777248 GCTGGAGCCCAGAGAGAAGATGG - Intronic
1062036179 9:134383609-134383631 CCTGGTTCCCAGAGTGGGGCGGG - Intronic
1062049766 9:134441199-134441221 GCCTGTGCCCAGAGCTAGGGTGG + Intergenic
1062070494 9:134552775-134552797 GATGGTGCCCAGGGTGTGGCTGG - Intergenic
1062385691 9:136310678-136310700 GCTGGGGCCCAGAGGGTGGGGGG - Intergenic
1062416199 9:136451527-136451549 TCTGGTGACCAGAGGGAGGCAGG + Intronic
1062432228 9:136531347-136531369 GATGGGGACCAGAGCGGGGCAGG + Intronic
1062501627 9:136854348-136854370 GTGGGGGCCCAGAGTGAGGCTGG + Intronic
1062581964 9:137232716-137232738 ACGGGTGCCCAGGGCGGGGCGGG + Intronic
1062601108 9:137318944-137318966 CAGGGTTCCCAGAGCGAGGCTGG - Intronic
1062658327 9:137615372-137615394 GAGGGTGCCCAAGGCGAGGCCGG - Exonic
1186855204 X:13619724-13619746 TCTGCTGCCCTGAGCTAGGCTGG + Intronic
1187232338 X:17434941-17434963 GCTGGAGCCCTGGGCCAGGCTGG + Intronic
1189350258 X:40270575-40270597 GCTGATGCTCAGAGCAGGGCTGG - Intergenic
1191800466 X:65073458-65073480 GCTGGGGCCCTGGGAGAGGCCGG + Intergenic
1195310697 X:103629400-103629422 GCTGGTGCCCAGAAAGTGGGGGG + Intronic
1196102248 X:111858778-111858800 GCTGGGGCACAGAGGAAGGCAGG - Intronic
1196764975 X:119235390-119235412 GCTGGAGCCCAGACAAAGGCGGG - Intergenic
1197744847 X:129925192-129925214 GCTGGTGAGCAGAGCCAGGGTGG + Exonic
1199409720 X:147507164-147507186 GCTGGTGCCACGAGGGGGGCAGG - Intergenic
1200056239 X:153462835-153462857 GCTGATGCCCAGAGAGGGGTGGG - Intronic
1200104641 X:153705554-153705576 GCTGTAGCCCAGTGCGGGGCAGG - Intronic
1200207411 X:154327117-154327139 GCTGGGACCCACAGCCAGGCGGG - Intronic
1200235531 X:154466174-154466196 GCTGGTGCCCAGCCCGCCGCCGG + Exonic
1200252255 X:154559872-154559894 GCTGCTGCCCAGAGCTCTGCTGG - Intronic
1200265513 X:154644544-154644566 GCTGCTGCCCAGAGCTCTGCTGG + Intergenic
1200519774 Y:4195958-4195980 GGTGGCGCCCAGAGCGAGTGAGG + Intergenic