ID: 1123043470

View in Genome Browser
Species Human (GRCh38)
Location 14:105499961-105499983
Sequence GTCCACCCCTGGGACCAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123043470_1123043483 22 Left 1123043470 14:105499961-105499983 CCTCCTTGGTCCCAGGGGTGGAC No data
Right 1123043483 14:105500006-105500028 CATTCCGGTGCATGGGACCCAGG No data
1123043470_1123043479 15 Left 1123043470 14:105499961-105499983 CCTCCTTGGTCCCAGGGGTGGAC No data
Right 1123043479 14:105499999-105500021 GCCTTCCCATTCCGGTGCATGGG No data
1123043470_1123043478 14 Left 1123043470 14:105499961-105499983 CCTCCTTGGTCCCAGGGGTGGAC No data
Right 1123043478 14:105499998-105500020 TGCCTTCCCATTCCGGTGCATGG No data
1123043470_1123043475 7 Left 1123043470 14:105499961-105499983 CCTCCTTGGTCCCAGGGGTGGAC No data
Right 1123043475 14:105499991-105500013 GACCGCCTGCCTTCCCATTCCGG No data
1123043470_1123043485 30 Left 1123043470 14:105499961-105499983 CCTCCTTGGTCCCAGGGGTGGAC No data
Right 1123043485 14:105500014-105500036 TGCATGGGACCCAGGAGCACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123043470 Original CRISPR GTCCACCCCTGGGACCAAGG AGG (reversed) Intergenic
No off target data available for this crispr