ID: 1123043474

View in Genome Browser
Species Human (GRCh38)
Location 14:105499987-105500009
Sequence AATGGGAAGGCAGGCGGTCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123043474_1123043485 4 Left 1123043474 14:105499987-105500009 CCTAGACCGCCTGCCTTCCCATT No data
Right 1123043485 14:105500014-105500036 TGCATGGGACCCAGGAGCACCGG No data
1123043474_1123043483 -4 Left 1123043474 14:105499987-105500009 CCTAGACCGCCTGCCTTCCCATT No data
Right 1123043483 14:105500006-105500028 CATTCCGGTGCATGGGACCCAGG No data
1123043474_1123043488 14 Left 1123043474 14:105499987-105500009 CCTAGACCGCCTGCCTTCCCATT No data
Right 1123043488 14:105500024-105500046 CCAGGAGCACCGGCAAGACCTGG No data
1123043474_1123043491 29 Left 1123043474 14:105499987-105500009 CCTAGACCGCCTGCCTTCCCATT No data
Right 1123043491 14:105500039-105500061 AGACCTGGCCGTGGCCAGCAAGG No data
1123043474_1123043489 20 Left 1123043474 14:105499987-105500009 CCTAGACCGCCTGCCTTCCCATT No data
Right 1123043489 14:105500030-105500052 GCACCGGCAAGACCTGGCCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123043474 Original CRISPR AATGGGAAGGCAGGCGGTCT AGG (reversed) Intergenic
No off target data available for this crispr