ID: 1123043477

View in Genome Browser
Species Human (GRCh38)
Location 14:105499996-105500018
Sequence ATGCACCGGAATGGGAAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123043477_1123043485 -5 Left 1123043477 14:105499996-105500018 CCTGCCTTCCCATTCCGGTGCAT No data
Right 1123043485 14:105500014-105500036 TGCATGGGACCCAGGAGCACCGG No data
1123043477_1123043489 11 Left 1123043477 14:105499996-105500018 CCTGCCTTCCCATTCCGGTGCAT No data
Right 1123043489 14:105500030-105500052 GCACCGGCAAGACCTGGCCGTGG No data
1123043477_1123043488 5 Left 1123043477 14:105499996-105500018 CCTGCCTTCCCATTCCGGTGCAT No data
Right 1123043488 14:105500024-105500046 CCAGGAGCACCGGCAAGACCTGG No data
1123043477_1123043491 20 Left 1123043477 14:105499996-105500018 CCTGCCTTCCCATTCCGGTGCAT No data
Right 1123043491 14:105500039-105500061 AGACCTGGCCGTGGCCAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123043477 Original CRISPR ATGCACCGGAATGGGAAGGC AGG (reversed) Intergenic
No off target data available for this crispr