ID: 1123043482

View in Genome Browser
Species Human (GRCh38)
Location 14:105500005-105500027
Sequence CTGGGTCCCATGCACCGGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123043482_1123043494 24 Left 1123043482 14:105500005-105500027 CCATTCCGGTGCATGGGACCCAG No data
Right 1123043494 14:105500052-105500074 GCCAGCAAGGCCTCCCTTTCAGG No data
1123043482_1123043489 2 Left 1123043482 14:105500005-105500027 CCATTCCGGTGCATGGGACCCAG No data
Right 1123043489 14:105500030-105500052 GCACCGGCAAGACCTGGCCGTGG No data
1123043482_1123043488 -4 Left 1123043482 14:105500005-105500027 CCATTCCGGTGCATGGGACCCAG No data
Right 1123043488 14:105500024-105500046 CCAGGAGCACCGGCAAGACCTGG No data
1123043482_1123043491 11 Left 1123043482 14:105500005-105500027 CCATTCCGGTGCATGGGACCCAG No data
Right 1123043491 14:105500039-105500061 AGACCTGGCCGTGGCCAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123043482 Original CRISPR CTGGGTCCCATGCACCGGAA TGG (reversed) Intergenic
No off target data available for this crispr