ID: 1123043485

View in Genome Browser
Species Human (GRCh38)
Location 14:105500014-105500036
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123043476_1123043485 -2 Left 1123043476 14:105499993-105500015 CCGCCTGCCTTCCCATTCCGGTG No data
Right 1123043485 14:105500014-105500036 TGCATGGGACCCAGGAGCACCGG No data
1123043477_1123043485 -5 Left 1123043477 14:105499996-105500018 CCTGCCTTCCCATTCCGGTGCAT No data
Right 1123043485 14:105500014-105500036 TGCATGGGACCCAGGAGCACCGG No data
1123043471_1123043485 27 Left 1123043471 14:105499964-105499986 CCTTGGTCCCAGGGGTGGACACG No data
Right 1123043485 14:105500014-105500036 TGCATGGGACCCAGGAGCACCGG No data
1123043480_1123043485 -9 Left 1123043480 14:105500000-105500022 CCTTCCCATTCCGGTGCATGGGA No data
Right 1123043485 14:105500014-105500036 TGCATGGGACCCAGGAGCACCGG No data
1123043473_1123043485 19 Left 1123043473 14:105499972-105499994 CCAGGGGTGGACACGCCTAGACC No data
Right 1123043485 14:105500014-105500036 TGCATGGGACCCAGGAGCACCGG No data
1123043474_1123043485 4 Left 1123043474 14:105499987-105500009 CCTAGACCGCCTGCCTTCCCATT No data
Right 1123043485 14:105500014-105500036 TGCATGGGACCCAGGAGCACCGG No data
1123043472_1123043485 20 Left 1123043472 14:105499971-105499993 CCCAGGGGTGGACACGCCTAGAC No data
Right 1123043485 14:105500014-105500036 TGCATGGGACCCAGGAGCACCGG No data
1123043470_1123043485 30 Left 1123043470 14:105499961-105499983 CCTCCTTGGTCCCAGGGGTGGAC No data
Right 1123043485 14:105500014-105500036 TGCATGGGACCCAGGAGCACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123043485 Original CRISPR TGCATGGGACCCAGGAGCAC CGG Intergenic