ID: 1123043486

View in Genome Browser
Species Human (GRCh38)
Location 14:105500023-105500045
Sequence CAGGTCTTGCCGGTGCTCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123043486_1123043491 -7 Left 1123043486 14:105500023-105500045 CCCAGGAGCACCGGCAAGACCTG No data
Right 1123043491 14:105500039-105500061 AGACCTGGCCGTGGCCAGCAAGG No data
1123043486_1123043494 6 Left 1123043486 14:105500023-105500045 CCCAGGAGCACCGGCAAGACCTG No data
Right 1123043494 14:105500052-105500074 GCCAGCAAGGCCTCCCTTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123043486 Original CRISPR CAGGTCTTGCCGGTGCTCCT GGG (reversed) Intergenic
No off target data available for this crispr