ID: 1123043487

View in Genome Browser
Species Human (GRCh38)
Location 14:105500024-105500046
Sequence CCAGGTCTTGCCGGTGCTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123043487_1123043491 -8 Left 1123043487 14:105500024-105500046 CCAGGAGCACCGGCAAGACCTGG No data
Right 1123043491 14:105500039-105500061 AGACCTGGCCGTGGCCAGCAAGG No data
1123043487_1123043494 5 Left 1123043487 14:105500024-105500046 CCAGGAGCACCGGCAAGACCTGG No data
Right 1123043494 14:105500052-105500074 GCCAGCAAGGCCTCCCTTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123043487 Original CRISPR CCAGGTCTTGCCGGTGCTCC TGG (reversed) Intergenic
No off target data available for this crispr