ID: 1123043488

View in Genome Browser
Species Human (GRCh38)
Location 14:105500024-105500046
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123043473_1123043488 29 Left 1123043473 14:105499972-105499994 CCAGGGGTGGACACGCCTAGACC No data
Right 1123043488 14:105500024-105500046 CCAGGAGCACCGGCAAGACCTGG No data
1123043480_1123043488 1 Left 1123043480 14:105500000-105500022 CCTTCCCATTCCGGTGCATGGGA No data
Right 1123043488 14:105500024-105500046 CCAGGAGCACCGGCAAGACCTGG No data
1123043477_1123043488 5 Left 1123043477 14:105499996-105500018 CCTGCCTTCCCATTCCGGTGCAT No data
Right 1123043488 14:105500024-105500046 CCAGGAGCACCGGCAAGACCTGG No data
1123043474_1123043488 14 Left 1123043474 14:105499987-105500009 CCTAGACCGCCTGCCTTCCCATT No data
Right 1123043488 14:105500024-105500046 CCAGGAGCACCGGCAAGACCTGG No data
1123043481_1123043488 -3 Left 1123043481 14:105500004-105500026 CCCATTCCGGTGCATGGGACCCA No data
Right 1123043488 14:105500024-105500046 CCAGGAGCACCGGCAAGACCTGG No data
1123043484_1123043488 -9 Left 1123043484 14:105500010-105500032 CCGGTGCATGGGACCCAGGAGCA No data
Right 1123043488 14:105500024-105500046 CCAGGAGCACCGGCAAGACCTGG No data
1123043472_1123043488 30 Left 1123043472 14:105499971-105499993 CCCAGGGGTGGACACGCCTAGAC No data
Right 1123043488 14:105500024-105500046 CCAGGAGCACCGGCAAGACCTGG No data
1123043476_1123043488 8 Left 1123043476 14:105499993-105500015 CCGCCTGCCTTCCCATTCCGGTG No data
Right 1123043488 14:105500024-105500046 CCAGGAGCACCGGCAAGACCTGG No data
1123043482_1123043488 -4 Left 1123043482 14:105500005-105500027 CCATTCCGGTGCATGGGACCCAG No data
Right 1123043488 14:105500024-105500046 CCAGGAGCACCGGCAAGACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123043488 Original CRISPR CCAGGAGCACCGGCAAGACC TGG Intergenic