ID: 1123043489

View in Genome Browser
Species Human (GRCh38)
Location 14:105500030-105500052
Sequence GCACCGGCAAGACCTGGCCG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123043481_1123043489 3 Left 1123043481 14:105500004-105500026 CCCATTCCGGTGCATGGGACCCA No data
Right 1123043489 14:105500030-105500052 GCACCGGCAAGACCTGGCCGTGG No data
1123043477_1123043489 11 Left 1123043477 14:105499996-105500018 CCTGCCTTCCCATTCCGGTGCAT No data
Right 1123043489 14:105500030-105500052 GCACCGGCAAGACCTGGCCGTGG No data
1123043484_1123043489 -3 Left 1123043484 14:105500010-105500032 CCGGTGCATGGGACCCAGGAGCA No data
Right 1123043489 14:105500030-105500052 GCACCGGCAAGACCTGGCCGTGG No data
1123043482_1123043489 2 Left 1123043482 14:105500005-105500027 CCATTCCGGTGCATGGGACCCAG No data
Right 1123043489 14:105500030-105500052 GCACCGGCAAGACCTGGCCGTGG No data
1123043480_1123043489 7 Left 1123043480 14:105500000-105500022 CCTTCCCATTCCGGTGCATGGGA No data
Right 1123043489 14:105500030-105500052 GCACCGGCAAGACCTGGCCGTGG No data
1123043476_1123043489 14 Left 1123043476 14:105499993-105500015 CCGCCTGCCTTCCCATTCCGGTG No data
Right 1123043489 14:105500030-105500052 GCACCGGCAAGACCTGGCCGTGG No data
1123043474_1123043489 20 Left 1123043474 14:105499987-105500009 CCTAGACCGCCTGCCTTCCCATT No data
Right 1123043489 14:105500030-105500052 GCACCGGCAAGACCTGGCCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123043489 Original CRISPR GCACCGGCAAGACCTGGCCG TGG Intergenic
No off target data available for this crispr