ID: 1123043491

View in Genome Browser
Species Human (GRCh38)
Location 14:105500039-105500061
Sequence AGACCTGGCCGTGGCCAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123043482_1123043491 11 Left 1123043482 14:105500005-105500027 CCATTCCGGTGCATGGGACCCAG No data
Right 1123043491 14:105500039-105500061 AGACCTGGCCGTGGCCAGCAAGG No data
1123043476_1123043491 23 Left 1123043476 14:105499993-105500015 CCGCCTGCCTTCCCATTCCGGTG No data
Right 1123043491 14:105500039-105500061 AGACCTGGCCGTGGCCAGCAAGG No data
1123043484_1123043491 6 Left 1123043484 14:105500010-105500032 CCGGTGCATGGGACCCAGGAGCA No data
Right 1123043491 14:105500039-105500061 AGACCTGGCCGTGGCCAGCAAGG No data
1123043474_1123043491 29 Left 1123043474 14:105499987-105500009 CCTAGACCGCCTGCCTTCCCATT No data
Right 1123043491 14:105500039-105500061 AGACCTGGCCGTGGCCAGCAAGG No data
1123043486_1123043491 -7 Left 1123043486 14:105500023-105500045 CCCAGGAGCACCGGCAAGACCTG No data
Right 1123043491 14:105500039-105500061 AGACCTGGCCGTGGCCAGCAAGG No data
1123043487_1123043491 -8 Left 1123043487 14:105500024-105500046 CCAGGAGCACCGGCAAGACCTGG No data
Right 1123043491 14:105500039-105500061 AGACCTGGCCGTGGCCAGCAAGG No data
1123043480_1123043491 16 Left 1123043480 14:105500000-105500022 CCTTCCCATTCCGGTGCATGGGA No data
Right 1123043491 14:105500039-105500061 AGACCTGGCCGTGGCCAGCAAGG No data
1123043481_1123043491 12 Left 1123043481 14:105500004-105500026 CCCATTCCGGTGCATGGGACCCA No data
Right 1123043491 14:105500039-105500061 AGACCTGGCCGTGGCCAGCAAGG No data
1123043477_1123043491 20 Left 1123043477 14:105499996-105500018 CCTGCCTTCCCATTCCGGTGCAT No data
Right 1123043491 14:105500039-105500061 AGACCTGGCCGTGGCCAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123043491 Original CRISPR AGACCTGGCCGTGGCCAGCA AGG Intergenic
No off target data available for this crispr