ID: 1123043494

View in Genome Browser
Species Human (GRCh38)
Location 14:105500052-105500074
Sequence GCCAGCAAGGCCTCCCTTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123043482_1123043494 24 Left 1123043482 14:105500005-105500027 CCATTCCGGTGCATGGGACCCAG No data
Right 1123043494 14:105500052-105500074 GCCAGCAAGGCCTCCCTTTCAGG No data
1123043480_1123043494 29 Left 1123043480 14:105500000-105500022 CCTTCCCATTCCGGTGCATGGGA No data
Right 1123043494 14:105500052-105500074 GCCAGCAAGGCCTCCCTTTCAGG No data
1123043486_1123043494 6 Left 1123043486 14:105500023-105500045 CCCAGGAGCACCGGCAAGACCTG No data
Right 1123043494 14:105500052-105500074 GCCAGCAAGGCCTCCCTTTCAGG No data
1123043481_1123043494 25 Left 1123043481 14:105500004-105500026 CCCATTCCGGTGCATGGGACCCA No data
Right 1123043494 14:105500052-105500074 GCCAGCAAGGCCTCCCTTTCAGG No data
1123043490_1123043494 -4 Left 1123043490 14:105500033-105500055 CCGGCAAGACCTGGCCGTGGCCA No data
Right 1123043494 14:105500052-105500074 GCCAGCAAGGCCTCCCTTTCAGG No data
1123043484_1123043494 19 Left 1123043484 14:105500010-105500032 CCGGTGCATGGGACCCAGGAGCA No data
Right 1123043494 14:105500052-105500074 GCCAGCAAGGCCTCCCTTTCAGG No data
1123043487_1123043494 5 Left 1123043487 14:105500024-105500046 CCAGGAGCACCGGCAAGACCTGG No data
Right 1123043494 14:105500052-105500074 GCCAGCAAGGCCTCCCTTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123043494 Original CRISPR GCCAGCAAGGCCTCCCTTTC AGG Intergenic
No off target data available for this crispr