ID: 1123043521

View in Genome Browser
Species Human (GRCh38)
Location 14:105500164-105500186
Sequence CCTTAGGAGGAGCTGGCGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123043521_1123043529 1 Left 1123043521 14:105500164-105500186 CCCTCCGCCAGCTCCTCCTAAGG No data
Right 1123043529 14:105500188-105500210 CTCCTGCCACCTCCACCTGCTGG No data
1123043521_1123043535 19 Left 1123043521 14:105500164-105500186 CCCTCCGCCAGCTCCTCCTAAGG No data
Right 1123043535 14:105500206-105500228 GCTGGTTCCAGCTCTGTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123043521 Original CRISPR CCTTAGGAGGAGCTGGCGGA GGG (reversed) Intergenic
No off target data available for this crispr