ID: 1123044625

View in Genome Browser
Species Human (GRCh38)
Location 14:105505302-105505324
Sequence TCCTCCGAGGACGGCCTCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123044616_1123044625 28 Left 1123044616 14:105505251-105505273 CCCGTGGACGAGGGGTCTTAGCT No data
Right 1123044625 14:105505302-105505324 TCCTCCGAGGACGGCCTCACTGG No data
1123044617_1123044625 27 Left 1123044617 14:105505252-105505274 CCGTGGACGAGGGGTCTTAGCTG No data
Right 1123044625 14:105505302-105505324 TCCTCCGAGGACGGCCTCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123044625 Original CRISPR TCCTCCGAGGACGGCCTCAC TGG Intergenic