ID: 1123051065

View in Genome Browser
Species Human (GRCh38)
Location 14:105542837-105542859
Sequence GGAGCTGTTGCAAGAGATAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123051059_1123051065 30 Left 1123051059 14:105542784-105542806 CCACATTGAAAACACTGTAGGAA No data
Right 1123051065 14:105542837-105542859 GGAGCTGTTGCAAGAGATACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123051065 Original CRISPR GGAGCTGTTGCAAGAGATAC AGG Intergenic
No off target data available for this crispr