ID: 1123051930

View in Genome Browser
Species Human (GRCh38)
Location 14:105548127-105548149
Sequence CAGGCCGGAGCCCATGCCGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123051930_1123051941 24 Left 1123051930 14:105548127-105548149 CCGCCGGCATGGGCTCCGGCCTG No data
Right 1123051941 14:105548174-105548196 GCCCCCTGCTCCACTGCGTCTGG No data
1123051930_1123051934 -8 Left 1123051930 14:105548127-105548149 CCGCCGGCATGGGCTCCGGCCTG No data
Right 1123051934 14:105548142-105548164 CCGGCCTGGCCCGAGCCTCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123051930 Original CRISPR CAGGCCGGAGCCCATGCCGG CGG (reversed) Intergenic
No off target data available for this crispr