ID: 1123053276

View in Genome Browser
Species Human (GRCh38)
Location 14:105557861-105557883
Sequence GCCCAAAGGAGAAACAGAGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123053276_1123053289 30 Left 1123053276 14:105557861-105557883 CCGACTCTGTTTCTCCTTTGGGC No data
Right 1123053289 14:105557914-105557936 GCCTCCGCGGGGCTGCGCTCGGG 0: 2
1: 0
2: 1
3: 12
4: 205
1123053276_1123053278 -6 Left 1123053276 14:105557861-105557883 CCGACTCTGTTTCTCCTTTGGGC No data
Right 1123053278 14:105557878-105557900 TTGGGCAGAAGAAGCCCTTGTGG No data
1123053276_1123053279 -5 Left 1123053276 14:105557861-105557883 CCGACTCTGTTTCTCCTTTGGGC No data
Right 1123053279 14:105557879-105557901 TGGGCAGAAGAAGCCCTTGTGGG No data
1123053276_1123053285 19 Left 1123053276 14:105557861-105557883 CCGACTCTGTTTCTCCTTTGGGC No data
Right 1123053285 14:105557903-105557925 GCCTCGGTCCAGCCTCCGCGGGG No data
1123053276_1123053288 29 Left 1123053276 14:105557861-105557883 CCGACTCTGTTTCTCCTTTGGGC No data
Right 1123053288 14:105557913-105557935 AGCCTCCGCGGGGCTGCGCTCGG No data
1123053276_1123053284 18 Left 1123053276 14:105557861-105557883 CCGACTCTGTTTCTCCTTTGGGC No data
Right 1123053284 14:105557902-105557924 AGCCTCGGTCCAGCCTCCGCGGG No data
1123053276_1123053283 17 Left 1123053276 14:105557861-105557883 CCGACTCTGTTTCTCCTTTGGGC No data
Right 1123053283 14:105557901-105557923 GAGCCTCGGTCCAGCCTCCGCGG No data
1123053276_1123053280 3 Left 1123053276 14:105557861-105557883 CCGACTCTGTTTCTCCTTTGGGC No data
Right 1123053280 14:105557887-105557909 AGAAGCCCTTGTGGGAGCCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123053276 Original CRISPR GCCCAAAGGAGAAACAGAGT CGG (reversed) Intergenic