ID: 1123053277

View in Genome Browser
Species Human (GRCh38)
Location 14:105557875-105557897
Sequence CAAGGGCTTCTTCTGCCCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123053277_1123053293 21 Left 1123053277 14:105557875-105557897 CCTTTGGGCAGAAGAAGCCCTTG No data
Right 1123053293 14:105557919-105557941 CGCGGGGCTGCGCTCGGGCTGGG No data
1123053277_1123053283 3 Left 1123053277 14:105557875-105557897 CCTTTGGGCAGAAGAAGCCCTTG No data
Right 1123053283 14:105557901-105557923 GAGCCTCGGTCCAGCCTCCGCGG No data
1123053277_1123053292 20 Left 1123053277 14:105557875-105557897 CCTTTGGGCAGAAGAAGCCCTTG No data
Right 1123053292 14:105557918-105557940 CCGCGGGGCTGCGCTCGGGCTGG No data
1123053277_1123053288 15 Left 1123053277 14:105557875-105557897 CCTTTGGGCAGAAGAAGCCCTTG No data
Right 1123053288 14:105557913-105557935 AGCCTCCGCGGGGCTGCGCTCGG No data
1123053277_1123053284 4 Left 1123053277 14:105557875-105557897 CCTTTGGGCAGAAGAAGCCCTTG No data
Right 1123053284 14:105557902-105557924 AGCCTCGGTCCAGCCTCCGCGGG No data
1123053277_1123053285 5 Left 1123053277 14:105557875-105557897 CCTTTGGGCAGAAGAAGCCCTTG No data
Right 1123053285 14:105557903-105557925 GCCTCGGTCCAGCCTCCGCGGGG No data
1123053277_1123053294 24 Left 1123053277 14:105557875-105557897 CCTTTGGGCAGAAGAAGCCCTTG No data
Right 1123053294 14:105557922-105557944 GGGGCTGCGCTCGGGCTGGGTGG No data
1123053277_1123053289 16 Left 1123053277 14:105557875-105557897 CCTTTGGGCAGAAGAAGCCCTTG No data
Right 1123053289 14:105557914-105557936 GCCTCCGCGGGGCTGCGCTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123053277 Original CRISPR CAAGGGCTTCTTCTGCCCAA AGG (reversed) Intergenic