ID: 1123053280

View in Genome Browser
Species Human (GRCh38)
Location 14:105557887-105557909
Sequence AGAAGCCCTTGTGGGAGCCT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123053267_1123053280 20 Left 1123053267 14:105557844-105557866 CCCAGCCACTGCCTCCCCCGACT No data
Right 1123053280 14:105557887-105557909 AGAAGCCCTTGTGGGAGCCTCGG No data
1123053271_1123053280 6 Left 1123053271 14:105557858-105557880 CCCCCGACTCTGTTTCTCCTTTG No data
Right 1123053280 14:105557887-105557909 AGAAGCCCTTGTGGGAGCCTCGG No data
1123053269_1123053280 15 Left 1123053269 14:105557849-105557871 CCACTGCCTCCCCCGACTCTGTT No data
Right 1123053280 14:105557887-105557909 AGAAGCCCTTGTGGGAGCCTCGG No data
1123053274_1123053280 4 Left 1123053274 14:105557860-105557882 CCCGACTCTGTTTCTCCTTTGGG No data
Right 1123053280 14:105557887-105557909 AGAAGCCCTTGTGGGAGCCTCGG No data
1123053276_1123053280 3 Left 1123053276 14:105557861-105557883 CCGACTCTGTTTCTCCTTTGGGC No data
Right 1123053280 14:105557887-105557909 AGAAGCCCTTGTGGGAGCCTCGG No data
1123053268_1123053280 19 Left 1123053268 14:105557845-105557867 CCAGCCACTGCCTCCCCCGACTC No data
Right 1123053280 14:105557887-105557909 AGAAGCCCTTGTGGGAGCCTCGG No data
1123053270_1123053280 9 Left 1123053270 14:105557855-105557877 CCTCCCCCGACTCTGTTTCTCCT No data
Right 1123053280 14:105557887-105557909 AGAAGCCCTTGTGGGAGCCTCGG No data
1123053272_1123053280 5 Left 1123053272 14:105557859-105557881 CCCCGACTCTGTTTCTCCTTTGG No data
Right 1123053280 14:105557887-105557909 AGAAGCCCTTGTGGGAGCCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123053280 Original CRISPR AGAAGCCCTTGTGGGAGCCT CGG Intergenic