ID: 1123053282

View in Genome Browser
Species Human (GRCh38)
Location 14:105557893-105557915
Sequence GCTGGACCGAGGCTCCCACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123053282_1123053288 -3 Left 1123053282 14:105557893-105557915 CCTTGTGGGAGCCTCGGTCCAGC No data
Right 1123053288 14:105557913-105557935 AGCCTCCGCGGGGCTGCGCTCGG No data
1123053282_1123053293 3 Left 1123053282 14:105557893-105557915 CCTTGTGGGAGCCTCGGTCCAGC No data
Right 1123053293 14:105557919-105557941 CGCGGGGCTGCGCTCGGGCTGGG No data
1123053282_1123053292 2 Left 1123053282 14:105557893-105557915 CCTTGTGGGAGCCTCGGTCCAGC No data
Right 1123053292 14:105557918-105557940 CCGCGGGGCTGCGCTCGGGCTGG No data
1123053282_1123053294 6 Left 1123053282 14:105557893-105557915 CCTTGTGGGAGCCTCGGTCCAGC No data
Right 1123053294 14:105557922-105557944 GGGGCTGCGCTCGGGCTGGGTGG No data
1123053282_1123053289 -2 Left 1123053282 14:105557893-105557915 CCTTGTGGGAGCCTCGGTCCAGC No data
Right 1123053289 14:105557914-105557936 GCCTCCGCGGGGCTGCGCTCGGG No data
1123053282_1123053295 27 Left 1123053282 14:105557893-105557915 CCTTGTGGGAGCCTCGGTCCAGC No data
Right 1123053295 14:105557943-105557965 GGCGTCTCCTGCTCTTTCTTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123053282 Original CRISPR GCTGGACCGAGGCTCCCACA AGG (reversed) Intergenic