ID: 1123053283

View in Genome Browser
Species Human (GRCh38)
Location 14:105557901-105557923
Sequence GAGCCTCGGTCCAGCCTCCG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123053269_1123053283 29 Left 1123053269 14:105557849-105557871 CCACTGCCTCCCCCGACTCTGTT No data
Right 1123053283 14:105557901-105557923 GAGCCTCGGTCCAGCCTCCGCGG No data
1123053277_1123053283 3 Left 1123053277 14:105557875-105557897 CCTTTGGGCAGAAGAAGCCCTTG No data
Right 1123053283 14:105557901-105557923 GAGCCTCGGTCCAGCCTCCGCGG No data
1123053272_1123053283 19 Left 1123053272 14:105557859-105557881 CCCCGACTCTGTTTCTCCTTTGG No data
Right 1123053283 14:105557901-105557923 GAGCCTCGGTCCAGCCTCCGCGG No data
1123053276_1123053283 17 Left 1123053276 14:105557861-105557883 CCGACTCTGTTTCTCCTTTGGGC No data
Right 1123053283 14:105557901-105557923 GAGCCTCGGTCCAGCCTCCGCGG No data
1123053271_1123053283 20 Left 1123053271 14:105557858-105557880 CCCCCGACTCTGTTTCTCCTTTG No data
Right 1123053283 14:105557901-105557923 GAGCCTCGGTCCAGCCTCCGCGG No data
1123053274_1123053283 18 Left 1123053274 14:105557860-105557882 CCCGACTCTGTTTCTCCTTTGGG No data
Right 1123053283 14:105557901-105557923 GAGCCTCGGTCCAGCCTCCGCGG No data
1123053270_1123053283 23 Left 1123053270 14:105557855-105557877 CCTCCCCCGACTCTGTTTCTCCT No data
Right 1123053283 14:105557901-105557923 GAGCCTCGGTCCAGCCTCCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123053283 Original CRISPR GAGCCTCGGTCCAGCCTCCG CGG Intergenic