ID: 1123053286

View in Genome Browser
Species Human (GRCh38)
Location 14:105557904-105557926
Sequence GCCCCGCGGAGGCTGGACCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123053286_1123053294 -5 Left 1123053286 14:105557904-105557926 CCTCGGTCCAGCCTCCGCGGGGC No data
Right 1123053294 14:105557922-105557944 GGGGCTGCGCTCGGGCTGGGTGG No data
1123053286_1123053293 -8 Left 1123053286 14:105557904-105557926 CCTCGGTCCAGCCTCCGCGGGGC No data
Right 1123053293 14:105557919-105557941 CGCGGGGCTGCGCTCGGGCTGGG No data
1123053286_1123053295 16 Left 1123053286 14:105557904-105557926 CCTCGGTCCAGCCTCCGCGGGGC No data
Right 1123053295 14:105557943-105557965 GGCGTCTCCTGCTCTTTCTTCGG No data
1123053286_1123053292 -9 Left 1123053286 14:105557904-105557926 CCTCGGTCCAGCCTCCGCGGGGC No data
Right 1123053292 14:105557918-105557940 CCGCGGGGCTGCGCTCGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123053286 Original CRISPR GCCCCGCGGAGGCTGGACCG AGG (reversed) Intergenic