ID: 1123053288

View in Genome Browser
Species Human (GRCh38)
Location 14:105557913-105557935
Sequence AGCCTCCGCGGGGCTGCGCT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123053274_1123053288 30 Left 1123053274 14:105557860-105557882 CCCGACTCTGTTTCTCCTTTGGG No data
Right 1123053288 14:105557913-105557935 AGCCTCCGCGGGGCTGCGCTCGG No data
1123053281_1123053288 -2 Left 1123053281 14:105557892-105557914 CCCTTGTGGGAGCCTCGGTCCAG No data
Right 1123053288 14:105557913-105557935 AGCCTCCGCGGGGCTGCGCTCGG No data
1123053277_1123053288 15 Left 1123053277 14:105557875-105557897 CCTTTGGGCAGAAGAAGCCCTTG No data
Right 1123053288 14:105557913-105557935 AGCCTCCGCGGGGCTGCGCTCGG No data
1123053282_1123053288 -3 Left 1123053282 14:105557893-105557915 CCTTGTGGGAGCCTCGGTCCAGC No data
Right 1123053288 14:105557913-105557935 AGCCTCCGCGGGGCTGCGCTCGG No data
1123053276_1123053288 29 Left 1123053276 14:105557861-105557883 CCGACTCTGTTTCTCCTTTGGGC No data
Right 1123053288 14:105557913-105557935 AGCCTCCGCGGGGCTGCGCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123053288 Original CRISPR AGCCTCCGCGGGGCTGCGCT CGG Intergenic